How will you react if I tell you that your body consists of 1 to 2.6 kg of bacteria? Shocked? Well, I can imagine your surprised face. Most people believe that bacteria are dangerous and are responsible for diseases and infections but this isn’t true. In fact the truth is, most of the bacteria are helpful in the functioning of a living body and are also capable of performing many other useful functions. These beneficial bacteria are present in huge numbers inside as well as outside our body. Well let’s check out various types of beneficial bacteria which not only help in proper functioning of our body but also contribute in many other functions in and outside the body. Some of the examples of helpful bacteria are Bifidobacterium, Rhizobium and E.coli.
Beneficial Bacteria – to Humans
Human body has millions of bacteria which participate in different functions of the body. As you know the amount of bacteria present in the body varies from 1 to 2.6 kg, this volume contains a huge number of bacteria. These bacteria can be present in all parts of the body but mostly they are found in the intestine where they help in the process of digestion. They also play a very important role in preventing bacterial infections in genital parts, like yeast infections. Some beneficial bacteria to humans are helpful in maintaining the pH of the body. Some are even involved in protecting the skin from many infections.
They are also helpful in the production of vitamin K and have an important role to play in the functioning of immune system. One of the most common bacteria which are helpful for humans is Escherichia coli. This bacteria is associated with the process of digestion. It is present in the large intestine where the maximum digestion takes place. These bacteria release enzymes which help in the process of digestion and synthesis of various vitamins and nutrients. Beneficial bacteria are also very helpful for the pregnant women. They reduce the chances of postpartum complications and also protects the baby from fungal infections.
Answer:
Probiotics are live bacteria that are good for us, that balance our good and bad intestinal bacteria, and that aid in digestion of food and help with digestive problems, such as diarrhea and bellyache. Bacteria that are examples of probiotics are Lactobacilli and Bifidobacterium.
A new drug is discovered for the treatment of thyroid cancer. Which is a logical next step of the scientific method after the discovery has been successfully tested?
keeping the information private
testing the drug on animals
sharing the data with other scientists
testing the drug on people
Answer:
The answer would probably be either c or d
What type of muscle has a primary purpose of animal movement?
A) cardiac muscle
B) smooth muscle
C) tendons
D) skeletal muscle
Answer:
B. Smooth Muscle
Explanation:
Medusae are among the simplest animals that use muscles to make rhythmic movements. In at least some medusae, the circular muscles, which do most of the work of swimming, are striated. In contrast, most of the other muscles of cnidarians are smooth.
Answer:
D) skeletal muscle
Explanation:
skeletal muscle cells join together to form fascicles, and fascicles form the skeletal muscle.
Fossils usually occur in metamorphic rock. true or false?
Answer:
false
Explanation:
They can't survive the great pressures metamorphic rocks go through. They usually are only in sedimentary rocks. Hope this helps!
Answer:
false
Explanation:
Fossils are very fragile and metamorphic rocks go through some harsh changes, so i'd be impossible for fossils to stay intact or even form in metamorphic rocks
why does the cell get longer during anaphase
Answer:chromosomes are separated by a structure called the mitotic spindle and then pulled by the spindle to opposite poles of the cell
Explanation:
what’s the chemical reaction for the digestion of fats.
Answer: The chemical reaction for the digestion of fats is when A triester is produced through the chemical reaction of three fatty acid molecules with glycerol, a molecule that contains three hydroxyl groups. When fats are broken down these fatty acid chains and glycerol are free for the body to use.
Explanation:
Lipids (fats and oils)
Lipase enzymes break down fat into fatty acids and glycerol. Digestion of fat in the small intestine is helped by bile, made in the liver. Bile breaks the fat into small droplets that are easier for the lipase enzymes to work on. Bile is not an enzyme.
Cell specialization is important during the growth and development of a multicellular organism. This process is most directly regulated by _____________.
Answer:
atp
Explanation:
helppp hah im stuck with this
Answer:
oh
Explanation:
If the color differences were less distinct (ex. all butterflies were only shades of reds and oranges), would you expect similar results? Explain what you would expect and why.
Answer:
If the color differences were less distinct (ex. all butterflies were only shades of reds and oranges), would you expect similar results? ... That the predator has the ability to associate the prey to the sickness, and that the predator can distinguish the color difference.
Explanation:
The predator has the ability to associate the prey to the sickness, and that the predator can distinguish the color difference.
What the Viceroy's color pattern evolved?The Viceroy's color pattern has been evolved because the natural selection favoured them. The viceroy butterfly camouflage as the monarch butterfly as well as the exhibit Mullerian mimicry where as these two toxic species has the mimic each other for their benefit and by time natural selection has been favoured these.
Natural selection has been the process by which the reproductively fitest has the populations of the living organisms survive, adapt and change. The viceroy butterfly has the brush-footed butterfly having the dark orange colour with the black veins and row of the white spots on the border of its wings.
Monarch butterfly has the same as that of the viceroy except that it has the black horizontal stripes that has cross the bottom of its back wings. Species has refers to the group of the organisms which have the similar features and which are able to be interbreed to produce the viable and the fertile offspring.
Therefore, reproductive isolation prevents interbreeding between members of different species. It includes a collection of behavioral, evolutionary, and physiological processes.
Learn more about reproductive isolation on:
https://brainly.com/question/3089401
#SPJ3
Which is not a characteristic of a Prokaryote?
A) Simple
B) Has a nucleus
C) Replicates via cloning
D) Always single cell
Answer:A
Explanation:
how does the nitrogen cycle start from nitrites and end with nitrates? (full answer)
Explanation:
The nitrogen cycle seems to be the nitrogen form of recycling, that requires fixing of nitrogen, Teodoro mamoncillo, nitrogen removal, and deionization. The mechanism whereby the nitrogen and nitrites are subsequently converted to nitrogen fixation is denitrification.
Which mechanism of transport takes place without expending cellular energy?
Active
Hypotonic
Isotonic
Passive
Answer:
c
Explanation:
PLEASE HELP
Which process does this picture show?*
Transcription
Translation
Replication
Transformation
What cellular structure begins to reform during telophase?
Answer:
nuclear membrane
Explanation:
In a chemical bond between two or more atoms, what creates the bond?
A. Proton pairs
B. Electron pairs
C. Diametric energy force
D. The nucleus
Answer:
I think C diameteic energy may be right ans\
The conditions for an enzyme to work need to be?
Does all human activity have a negative impact on the environment and
ecosystems? *
A:NO
B:YES
Please help for my homework
Answer:
No
Explanation:
Answer:
A. NO
Explanation:
Because it depends if the activity. negatively or positively. Because humans can be very careful of how they affect the Earth and sometimes they can't.
Why is cellular differentiation
important for the development of a fully formed human infant?
Answer:
Cellular differentiation is necessary for the development of a fully formed human infants because cellular differentiation leads to the formation of different tissues and organs which are required for the development of human infant. Without tissues and organs our body cannot function properly.
Answer:
Cellular differentiation is necessary for the development of a fully formed human infants because cellular differentiation leads to the formation of different tissues and organs which are required for the development of human infant.
:
which principle did you apply in step 2 in the Investigation
Answer:
Do not pre-judge
Investigation must be trained and experience will be applied in step 2 in the Investigation.
What are the steps of investigation ?Scientific investigation is a continuous process of investigation which involve different steps to get the answer of a question by using scientific method.
The basic steps includes Investigators must be as independent, must be trained and experienced, all relevant issues must be identified, sufficiently resourced.
All relevant physical and digital evidence must be identified, collected , stored and examined during experiment, documentation must be secured and reviewed, witnesses must be identified.
The analysis of all the results must be gathered during the investigation must be objective oriented and based solely on the facts.
For more details regarding investigation , here
brainly.com/question/12877466
#SPJ2
Important vocabulary continued: what is the difference between a unicellular organism and a multicellular organism?
Answer:
unicellular is a organism that is only one cell. most of the time they are your bacteria and viruses. while a multicellular organism is a organism with many cells. can be anything from something you cant to to plants and animals that you can see
Explanation:
7 Which answer best describes
condensation?
A A gas changing into a liquid
B A liquid changing into a solid
C A solid changing into a liquid
D A liquid changing into a gas
Plz help I’ll mark brainliest
Answer:
I'm pretty sure it's exponential growth.
Explanation:
Answer:
expontential growth!!
Explanation:
Which action is harmful to organisms living in water ecosystems
A primary air pollutant is put directly into air by human activity.What is a secondary air pollutant
Answer:
Acid Rain
Explanation:
Acid rain, which is made up of several acidic compounds, forms when sulfur dioxide and nitrogen dioxide react in the air with water, oxygen and other chemicals. On the ground, acid rain damages plants and trees and increases the acidity levels of soils and bodies of water, causing damage to ecosystems. Acid rain also causes decay to buildings and can irritate the eyes and airways.
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
1.
Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?
2.
Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
3.
Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
Answer:
TAA ATT GAC AAG ACA GAT CTC
1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.
2. codon
three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).
3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.
OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)
3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.
What is a nucleotide sequence?A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.
Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.
Learn more about nucleotide sequence, here:
https://brainly.com/question/30299889
#SPJ6
What is the probability of getting a short pea plant when crossing the parents Tt with tt?
Answer:
50%
Explanation:
One half of the punnet square would be Tt and the other half would be tt.
The least amount of vertical change during the monthly tidal cycle occurs
a. At the beginning of the month
b. At the end of the month
c. at the quarter moons
d. at the full moon
What are the DNA strands called?
What is the RNA stand called?
Answer:
it rna means
Ribonucleic acid
Answer:
DNA strands - polynucleotides
RNA strand - nucleotide chain
Explanation:
DNA strands are known as polynucleotides because they are comprised of two nucleotide chains.
RNA is composed of a single nucleotide chain.
Hope this helps :)
Organisms are composed of many complex molecules. These molecules are composed mainly of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus. Which of the following statements most accurately describes how these molecules are made in ALL organisms?
Is glucose more or less complex than the rest of the biomolecules? Explain.
Answer:
Less complex.
Explanation:
Glucose is both a monomer and simple sugar.
Glucose is a monosaccharide. It is a biomolecule. It is less complex than the rest of the biomolecules, such as proteins, lipids, and other complex carbohydrates like glycogen.
What is a biomolecule?
Biomolecules are present inside the cell. Carbohydrates, proteins, and lipids are some examples of biomolecules. Carbohydrates are divided into monosaccharides, disaccharides, and polysaccharides.
A monosaccharide has a single unit. Examples are glucose, fructose, etc. A disaccharide consists of two units. An example is maltose. Maltose is made up of two units of glucose connected by a glycosidic bond. An example of a polysaccharide is glycogen. Multiple sugar units are connected by glycosidic bonds to form glycogen. It is a storage product.
Carbohydrates are present on our cell surface as peptidoglycan. Protein is a biomolecule that is made up of amino acid monomers. They make the different structures of a cell, such as actin fibers, etc. Lipid is made up of hydrogen and carbon. Examples are cholesterol, phospholipids, etc.
Hence, in comparison to all other biomolecules, glucose is the simplest.
To learn more about biomolecule, refer to the following link:
https://brainly.com/question/12299485
#SPJ2
Based on an analysis of the data, describe the effect of karrikins on seed
germination in the autotrophic host plants and the obligate parasitic weed plants.
Answer:
It triggers seed germination by activating hormone.
Explanation:
Karrikins has a great effect on seed germination in the plants as well as the obligate parasitic weed plants because it trigger the germination of seed by signaling of hormone known as strigolactone which is responsible for the germination of see. Karrikins are the group of plant growth regulators which is present in the smoke of burning plant.