what is poetry and tone?​

Answers

Answer 1

Answer:

In poetry, tone expresses the narrator’s disposition toward the poem’s subject, the reader, or the narrative itself. We might describe a poem’s tone as irreverent, relaxed, sarcastic, solemn, jubilant, or desperate.

Explanation:


Related Questions

(1) Your sister has gained admission into your former school . Write a letter giving her information about the school and advise her on how to behave well while in the school

Answers

Answer:

Nice, Done.

Explanation:

Not exactly, she was already going to the same as me but I explained her if she was in some type of situation what she would do and answer..ya✌

In paragraph 21, what does her father's advice to "pick up your feet" MOST LIKELY mean to Gatewood? O A. to learn new skills O B. to assess problems thoughtfully O C. to persevere despite difficulties O D. to go from place to place frequently​

Answers

Answer:

A

Explanation:

i pick A because you can learn new skills by watching them how to do things

what is the price of following the crowd in the wretched and the beautiful?

Answers

Answer:

The text shows the price of following the crowd because some people know that how the “wretched” aliens are being treated is wrong but they don't feel comfortable standing up for them when no one else is and because they look weird to them. Because of this the aliens get mistreated.

Explanation:

“One woman from among us offered to book a single room for the aliens for two nights, that being all she could afford on her teacher’s salary. She said this with undisguised hope, as if she thought her offer would inspire others. But silence followed her remark, and we avoided her eyes. “(24)

what does sinking bundle mean

Answers

A bundle of things is a number of them that are tied together or wrapped in a cloth or bag so that they can be carried or stored so a sinking bundle must mean the opposite.

does anyone know this ???

Answers

Answer: banana spilt

Explanation:

i did it before

“How has my personal experience shaped my view of individualism? Do I see it as a guiding principle, something to be avoided, or a combination of both?

Answers

Answer:

a combination of both because i learned to work by myself and also it show me how to do stuff by my self, and also you don't want to always be alone

Explanation:

My personal experience has shaped my view of individualism as it has taught me to be self reliant.

Individualism simply means a principle of being independent and self-reliant. It's the freedom of action for an individual.

This is important as it has made me believe in myself. I don't have to depend on other people to do things anymore.

Learn more about essays on:

https://brainly.com/question/25607827

The purpose for writing a personal narrative is

Answers

Answer:

The purpose is to describe a story in your life.

Explanation:

detailing the account with dialogue, the main events, setting, descriptions of people, and other personal observations

Which sentence BEST states a main idea of the passage? O A. Connecting with others is appealing. B. Taking a journey can bring fulfillment. C. Physical fitness becomes easier with age. O D. The dangers of hiking are often exaggerated.​

Answers

Answer:

b

Explanation:

In her diary, how does Anne Frank make a connection between herself and her mother?

Answers

Answer:

what are the options ????

Answer:

She includes dialogue in which her mother categorizes them both as bold and strong-willed.

Explanation:

Read the following passage carefully and answer the questions given below:
i. Polythene shopping bags and wrappers are a potential threat to urban environment. Once you have discarded them after use, you do not lose your link with them. They return to you in a variety of ways, though you do not realise it. For example, they choke your drains and provide breeding facilities to deadly germs.
ii. A recent study has shown that about 250 tonnes of plastic waste come out of various colonies of major cities every day. This disrupts the sewer system, the essential arteries of city life, choke the land mass and clog the pores of the wetlands.
iii. Unfortunately, even the villages and small towns are not free from this danger. Millions of people returning to their home towns everyday carry their shopping in colourful bags. This pleases their family and children, who after preserving them for a time dispose them in wells, rivers, tanks and drains. Many throw them off into the fields. They do it with a sense of pride, to show off. When their neighbours see that their men from the cities regularly send them those good things of life, they are impressed.
iv. All over the world the worst offenders are the upper income groups of the so-called posh colonies. Though educated, the residents of these affluent areas are unaware of the damage done by the plastic bags. Millions of children in schools carry their lunch boxes in plastic bags. They callously throw them away and cause an unhealthy environment.
v. As it is convenient for mothers to wrap the food in plastic, it is difficult to persuade them against doing this. According to a drill master of a school, it becomes a drill to clean the fields after the children leave. When the midday meal scheme is fully implemented, it must be seen that no plastic wrappers are used.
vi. As these wrappers are light in weight, they are borne aloft by the wind causing visual shocks. Unlike cotton or paper bags they remain undissolved in the mud and stop rain water from seeping deep in the earth. This affects the natural growth of greenery.
Questions:
a. How do polythene bags become health hazards?
b. What are the findings of the latest research about plastic waste?
c. How do the school children pollute the environment?
d. How do plastic bags hamper the growth of greenery?
e. Find the synonyms for the following words from the given passage:
thrown & wealthy
f. Find the antonyms for the following words from the given passage:
poor & shame
g. Give an appropriate title to the passage.
h. Write the meanings of the following words and frame sentences which should not match the content of the passage.
Damage & posh
i. Give the essence of the passage in not more than 75 words.

Answers

Orange yellow blue blue yellow red yblue gete r egwj w wuywuyou y. Orange. Orange. Hwbw efce erhebe

PART A: What impact does line 9 have on the tone of the poem?

Answers

Answer:

What impact does line 9 have on the tone of the poem? In line 9, John Donne abruptly changes the sentence structure of the poem, marking the switch away from the imperative that predominates the first eight lines. By inserting a sentence that is... Latest answer posted May 19, 2019 9:07 pm UTC

Can't see the poem... don't usually do this but, that is what Google says.

In his essay, Fielding identifies the problem of

Answers

Answer:0

Explanation:

Percentage of the known

In his essay, fielding identifies the problem to warn people of the danger of class warfare. Thus, option (c) is correct.

What is essay?

The term essay refers to the short piece of writing on a particular subject of the topic. The essay is writing for someone is convinced for someone. They simply inform the reader on particular topic. There are different types of essay such as argumentative, narrative, descriptive, and expository essay.

According to the essay, are the concern was the identify on the essay are the main reason to warn people to the most dangerous of class warfare. The warn people of the danger of class warfare in the society. The easy as the mention of the particular theme was the highlighted to describe the situation on the issue.

As a result, the fielding identifies the issue to warn people of the danger of class warfare. Therefore, option (c) is correct.

Learn more about on essay, here:

https://brainly.com/question/20426054

#SPJ2

Your question is incomplete, but most probably the full question was.

A. express his opinions about social class.

B. persuade lawmakers to implement reforms.

C. warn people of the danger of class warfare.

D. motivate readers to help poor people.

Based on the story thus far, what do you predict will happen with
the new cat? Explain your prediction based on what you have
read so far.

Answers

Answer:

As the new cat was liked by the wife, his fate or condition may be a bit different than that of Pluto, who the wife likens to the devil. Moreover, the narrator's guilt in killing Pluto may also play a part in his desire to not repeat the same monstrosity to the new animal.

Explanation:

Edgar Allen Poe's short story "The Black Cat" revolves around the story of how the unnamed narrator ended up as a death row prisoner. The short story illustrates how a person's mind can be the strongest influencer of one's character, even capable of bringing destruction.

The narrator had just killed his cat, Pluto out of anger which, he admits, he regretted the next day. And in his desire to get a replacement for the dead cat, he got a new one of almost the same appearance. He reveals "It was a black cat -- a very large one -- fully as large as Pluto, and closely resembling him in every respect but one. Pluto had not a white hair upon any portion of his body; but this cat had a large, although indefinite splotch of white, covering nearly the whole region of the breast." He also stated that the cat "purred" and "appeared delighted" to be with him, and in the end, both went home together.

But considering how the two got acquainted with each other, it seems like the same story all over again. The narrator will shower the new animal with love and attention, and the cat reciprocating the actions with its language. But what is different this time is that the wife liked the new cat while she did not like Pluto. This difference may become an important element in the later scenes.

Read the scenario about a formal discussion.
Which action should Charlotte take?
Www
During a class discussion, Tamika presents complex
information on the topic. Charlotte believes she
understands the information but wants to make sure her
understanding is correct.
Charlotte should paraphrase what was said so
Tamika can confirm Charlotte's understanding.
X Charlotte should interject immediately with a question
while Tamika is still presenting.
Charlotte should wait for other participants to questior
Tamika to confirm her understanding.
Charlotte should use body language to indicate that
she needs Tamika to clarify her main points.
see

Answers

Answer:

Charlotte should paraphrase what was said so  Tamika can confirm Charlotte's understanding.

Explanation:

In a class discussion, there are many instances of how one understands the information. As it is a group activity, there are chances that one's understanding may not be on the same level as others. But that does not mean one must try to "act" as if things are clear and need no further questioning.

In the given scenario, Charlotte feels she understands the information given by Tamika. But at the same time, she wants to confirm her understanding. To do that, she should paraphrase what has been said and then see if Tamika can confirm that. And through this, she will get the confirmation of whether what she understood was correct or she will find now information which will help clarify her problem.

Thus, the correct approach or action is the first option.

Charlotte should paraphrase what was said so option A: Tamika can confirm Charlotte's understanding.

Which action should Charlotte take?

In the given scenario, Charlotte feels she understands the information given by Tamika. But at the same time, she wants to confirm her understanding.

To do that, she should paraphrase what has been said and then see if Tamika can confirm that.

And through this, she will get the confirmation of whether what she understood was correct or she will find now information which will help clarify her problem.

Therefore, correct option is A.

Learn more about Charlotte, refer to the link:

https://brainly.com/question/4229601

#SPJ5

Which phrases in this excerpt from James Joyce's "a portrait of the artist as a young man" portray the story's setting?

Answers

Answer:

Wide playgrounds

Explanation:

From James Joyce's "A portrait of the artist as a young man", "wide playgrounds" portray the story's setting.

A story's setting is known to be the time and place of the story. In order words, it can be the geographical location of a place. Setting is a literary element used in novels, short stories, plays, etc.

The wide playgrounds give us the information of what one is to expect. This tells the reader that sports was going on. It gives the reader the location of where the story took place.

Answer:

1.) "wide playgrounds"

Explanation:

PLATO

What motivates Jim to shun the prosperous portion society?

Question 7 options:

A)

He gave up after many failed attempts.


B)

He would rather be lazy than fit in with them.


C)

He has to work too hard to go to parties.


D)

He is shy and they make fun of him.

Answers

Answer:

A is probably ur answer

Explanation:

but I'm not sure if I'm wrong My bad and At least I tried

Who is someone you thankful for and why?

Answers

Answer:

Wel..You should be thankfull for family, your health, wealth and happiness in life.You can also write that you are thankkfull for god giving you a chance on earth

Direct object pronouns can also be used to avoid repeating ________ that have already been mentioned.

Answers

Answer: direct object noun

Explanation:

Direct object pronouns can also be used to avoid repeating direct object noun that have already been mentioned

The direct object simply refers to the individual who received a particular action. For example, in the sentence. Bob sells shoes. The direct object is shoes.

The direct object pronoun is typically used instead of the direct object noun. Examples include her, him, them me, and us.


Which is the meaning of iconoclast in the paragraph?

Answers

Answer:

A person who attacks someone's beliefs or traditions.

Explanation:

Answer:

A person who attacks someone believe or culture

Drag the correct labels to the table.
Identify the achievements of the Phoenicians.

created shipbuilding techniques that are still in use today
made purple dye from murex shells
started city-states that were the foundation of democracy
made a complex drainage system that acted as a public sewer
learned how to navigate the Mediterranean Sea
created an alphabet made of 22 consonants

Which were achievments of Phoniceans

Answers

Here is the answer

I did this on Edmentum for school and I got it right lol

Answer:

person above is right!!!! :0 :)

Explanation:

What is a theme in "Law of the Jungle"?


Family is important.

Evil should be feared.

Forgiveness is powerful.

Revenge can be dangerous.
Question 2
Part B

Which evidence from the passage best supports the answer in Part A?


"And trouble not Hathi the Silent, and mock not the Boar in his lair."

"But kill not for pleasure of killing, and SEVEN TIMES NEVER KILL MAN."

"One haunch of each kill for her litter, and none may deny her the same."

"Remember the Wolf is a hunter—go forth and get food of thine own."

Answers

Answer:

These are the correct answers:)

Family is important.

"One haunch of each kill for her litter, and none may deny her the same."

Explanation:

I took the test on k12 and got these as my answers, also pls rate and thank!:)

Answer:

D: Rules are important for keeping order in society.

Sacrificing oneself is a great symbol of love.

Explanation:

im not sure if people got A right but it was wrong for me (2021 btw)

what is the text evidence in the recess queen

Answers

Answer:

Explanation:

The Recess Queen dives into the world of playground bullies and how students can handle those bullies. Mean Jean is, well, mean, but this changes when the new girl, Katie Sue, shows up. This is a great book for talking about how we react to others and how to handle difficult situations.

ITS EASY
Read the following passage carefully and answer the questions given below:
i. Polythene shopping bags and wrappers are a potential threat to urban environment. Once you have discarded them after use, you do not lose your link with them. They return to you in a variety of ways, though you do not realise it. For example, they choke your drains and provide breeding facilities to deadly germs.
ii. A recent study has shown that about 250 tonnes of plastic waste come out of various colonies of major cities every day. This disrupts the sewer system, the essential arteries of city life, choke the land mass and clog the pores of the wetlands.
iii. Unfortunately, even the villages and small towns are not free from this danger. Millions of people returning to their home towns everyday carry their shopping in colourful bags. This pleases their family and children, who after preserving them for a time dispose them in wells, rivers, tanks and drains. Many throw them off into the fields. They do it with a sense of pride, to show off. When their neighbours see that their men from the cities regularly send them those good things of life, they are impressed.
iv. All over the world the worst offenders are the upper income groups of the so-called posh colonies. Though educated, the residents of these affluent areas are unaware of the damage done by the plastic bags. Millions of children in schools carry their lunch boxes in plastic bags. They callously throw them away and cause an unhealthy environment.
v. As it is convenient for mothers to wrap the food in plastic, it is difficult to persuade them against doing this. According to a drill master of a school, it becomes a drill to clean the fields after the children leave. When the midday meal scheme is fully implemented, it must be seen that no plastic wrappers are used.
vi. As these wrappers are light in weight, they are borne aloft by the wind causing visual shocks. Unlike cotton or paper bags they remain undissolved in the mud and stop rain water from seeping deep in the earth. This affects the natural growth of greenery.
Questions:
a. How do polythene bags become health hazards?
b. What are the findings of the latest research about plastic waste?
c. How do the school children pollute the environment?
d. How do plastic bags hamper the growth of greenery?
e. Find the synonyms for the following words from the given passage:
thrown & wealthy
f. Find the antonyms for the following words from the given passage:
poor & shame
g. Give an appropriate title to the passage.
h. Write the meanings of the following words and frame sentences which should not match the content of the passage.
Damage & posh
i. Give the essence of the passage in not more than 75 words.

Answers

Answer:

Explanation:

kj

(PLS HELP!! ILL GIVE BRAINLIEST AND EXTRA POINTS!! IT MAY SEEM LONG BUT ITS REALLY NOT)

Read the passage:

Major cities all over the world are changing color. The tall buildings that make up the landscape of these urban environments are becoming greener. People are trying to help the environment and have found that green roofs are one way to do so. By planting grass and small shrubbery on the tops of buildings, the environment is getting a helping hand.

It is more expensive to build a green roof than it is to lay asphalt or shingles on a roof, but the trend is growing. The basic green roof requires a frame, waterproof membrane, gravel for drainage, fibrous material to retain moisture, soil for planting, and a barrier that prevents roots from penetrating the building.

Green roofs started in Europe and are now gaining a strong foothold in the United States. The largest green roof in New York City is built on the roof of a processing and distribution facility. It is actually the biggest green roof in the country. Being in New York, it has faced snow, rain, freezing, and thawing. It has survived it all.

The city of Chicago, Illinois, now has more green roofs than any other U.S. city. There are 7 million square feet of green roofs planted across the city. Toronto, Canada, is the first city in the western hemisphere to mandate green roofs on all new tall buildings. Green roofs are beneficial, not only to the environment, but also to the cities that build them. A recent study in Toronto suggested that if 75 percent of the flat roofs were greened, the city could save $37 million a year on storm water management and energy bills.

What evidence does the author use to support the idea that urban environments are becoming greener?


A) Being in New York, it has faced snow, rain, freezing, and thawing. It has survived it all.

B) The largest green roof in New York City is built on the roof of a processing and distribution facility.

C) It is more expensive to build a green roof than it is to lay asphalt or shingles.

D) People are trying to help the environment and have found that green roofs are one way to do so.

(Here is an image if needed) :

Answers

Answer:

i would say B.

Explanation:

hope this helps :)

The answer is (B) since it is an evidence.

What is the Anne's purpose in Act II, Scene 2 as she discusses her hopes?
She discusses her hopes and fears about the lack of any future with Peter so that he will reassure her.
She discusses her hopes about the end of the war and there being enough for everyone to eat because she is hungry.
She discusses her hopes and dreams for the future with Peter so that he has an understanding of her.
She discusses her hopes and dreams for the future with her mother so that her mother can support them.

Answers

Answer:

it is C

Explanation:

the answer is option 3 “She discusses her hopes and dreams for the future with Peter so that he has an understanding of her. ”

how can you work harder and work smarter , ILL MARK BRAINLIST

Answers

Answer:

Establish a morning routine.

Keep your to-do list short.

Establish a closing routine.

Block your calendar.

Respond quickly.

Measure your results, not your time.

Enhance your communication skills.

Make meetings productive.

Work in 90 to 120-minute blocks.

Focus on one task at a time.

Set short deadlines.

Practice stress management techniques.

Explanation:

The project ........ on time .
a) was not completed
b) was not completing by them
c) not completed
d) not complete by the ​

Answers

A was not completed on time

Answer:

a

Explanation:

that makes more sense than all other answers

What is believed about "plosive" consonants, such as b, p d, t, g, and K?
A. These letters look more interesting than others on a printed page.
B. These letters tend to be sadder than others in the alphabet.
C. These letters are inherently more comic than other letters.
D. These letters must be used in the same proportion as others.
SUBMIT

Answers

Answer:

c

Explanation:

Plosives are consonant sounds that begin with a stricture of the mouth that enables no air to exit from the vocal tract.

What do plosive sounds imply?

A plosive consonant is an abrupt sound produced by closing one's mouth and then exhaling a burst of air. In English, plosive consonants are B, P, T, and D. Their effect, especially when employed often, is to generate a linguistic reflection of harsh events, items, or emotions.

Thus, Option C is correct about the plosive constant.

For more information about Plosive refer to the link:

https://brainly.com/question/1392323

How to get all the common lit anwsers?

Answers

Just use Google they have all the answers

Instructions
Read the question carefully and select the best answer.
Which inference about the author is best supported by the following passage (paragraph 6)?
I return the dark snake to its nest among my mother's slips, arranging it so that its thin tail hides beneath the wide mouth sheared by
scissors. My mother keeps her promise and lets my hair grow long, but I am only half of her; my thin brown braids will reach the
middle of my back, and in maturity will look like tiny garden snakes,
A. She is afraid of her mother's braid, as if it were a snake.
B. She sees the braid as a symbol for the tragedy of her mother's lost hair
O C. She sees long braids of hair as symbols of strength
O D. She deeply misses her father.
TEKS: TEKS 7.5(F). TEKS.76(C), TEKS 79(A)
Save and continue

Answers

Answer:

A is the answer

Explanation:

she is afraid of her mother's braid as if it were a snake

The correct response is - She is afraid of her mother's braid as if it were a snake. Therefore option A is the correct response.

What is the mouth?'

A hollow inside the skull with an oval form is the mouth. Speaking and eating are the mouth's two primary uses. The lips, vestibule, mouth cavity, gums, teeth, hard and soft palate, tongue, and salivary glands are all components of the mouth. The oral cavity or buccal cavity are other terms for the mouth.

The mouth is what? Your digestive system includes your mouth. Your skull has an oval-shaped hole that extends from your throat to your lips. Your mouth helps you communicate and permits oxygen and nutrients to enter your body.

Concerns the mouth. The lips, the lining of the cheeks and lips, the upper and lower gums, the floor, and the front two-thirds of the tongue are all included.

To read more about the mouth, refer to - https://brainly.com/question/28274221

#SPJ2

Other Questions
Helppp ASAP. Emma wants to enlarge a square photo and print it to a square canvas. The sidelength of the canvas is 12 in. The scale from the canvas to the photo is 4 in. to 1 in.What is the side length of Emma's photo? Show your work. What other story element is most affected by the narrator's point of view?A) the story's titleB) the story's settingC) the story's theme Express the recurring decimal 0.56 (Just the 6 is recurring) in its simplest form. What should you ask yourself before you post a photo, video, or other information about another person online? 1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD PLZZ ANSWER THE QUESTION What point of view is the poem "The Song of the Storm -- Spirits" written in? The top of the saturated zone is known as A. the aquifer B. the water table C. the unsaturated zone D. spring rock How could you explain why soap is able to clean the oil and dirt off your bodies? Which of the following would be considered a derived unit? A) length B mass C) density D) temperature La hermana de mi hermana es mi ________. find y when y = 3x^2 -2x+5 and x = -1 What provides the energy that is stored in ATP molecules?A. PhospholipidB. FoodC. BloodD. Oxygen 72x2 + 39x + 207 = 0 does your faith is still visible even in the hardest part of life how?