Answer: Option C.
C)the tails of plant lipids cannot pack as tightly together as animal ones
Explanation:
The tails of plant lipids cannot pack as tightly together as animal ones because the double bond in plant lipids make the hydrocarbon chains to bend making them no to pack tightly together which cause a reduction in van der Waals interaction between the fatty acids. The length of the double bond also affect the melting point of fatty acids . If the hydrocarbon chain is long, melting point will be high .
What effect with the enzymes have on the time to make 1 MG of product
Answer:
Decreases
Explanation:
Enzymes speed up chemical reactions so the product is made in less time
SOMEONE PLZ HELP ME, PLZ I WILL MARK BRAINLIEST
Answer:
All living things are composed of cells.
Cells are the basic units of structure and function for living things.
All cells come from pre-existing cells. Also, organisms grow by “adding on more cells” NOT by increasing the size of their cells.
Explanation:
Explain how photosynthesis and cellular respiration work together.
Answer:
photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.
ILL GIVE BRAINLIST
Darren used the following soil triangle to identify a sample of soil as sandy loam.
Soil texture triangle. Clay soil is approximately 45 percent or less sand, 50 percent or more clay, and 40 percent or less silt. Silty loam soil is approximately 50 percent or less sand, 30 percent or less clay, and 50 percent or more silt. Sandy clay soil is approximately 45 to 65 percent sand, 35 to 55 percent clay, and 25 percent or less silt. Sandy clay loam soil is approximately 45 to 80 percent sand, 20 to 35 percent clay, and 35 percent or less silt.
Which description of soil likely allowed Darren to make this identification?
Mostly large particles, with a gritty texture, 60% sand, 10% clay, and 30% silt
Mostly large particles, with a smooth texture, 40% sand, 50% clay, and 10% silt
Mostly small particles, with a smooth texture, 10% sand, 50% clay, and 40% silt
Mostly small particles, with a smooth texture, 30% sand, 30% clay, and 40% silt
Answer: I'm not sure but i think it's Mostly small particles, with a smooth texture, 10% sand, 50% clay, and 40% silt
Explanation:
Soil Texture is defined as the proportion of sand, silt, and clay-sized particles, which make up the composition of the soil.
The description that matches Darren's identification is that most small particles, with a smooth texture, are 10% sand, 50% clay, and 40% silt.
The soil texture can be explained as:
1. Clay in soil texture refers to the mineral soil particles that are less than 0.2 millimeters in diameter. Clay soil is 40% or more clay, less than 45% sand, and less than 40% slit.
2. Silt in the soil texture has a high percentage of sand and it feels smooth, having smooth textures. This soil has a high percentage of clay.
3. Sand is the largest mineral particle, which consists of the coarsest particles. The particles feel gritty and have a diameter of about 0.05 to 0.002 mm.
Thus, the correct answer is Option C.
To know more about soil texture, refer to the following link:
https://brainly.com/question/8046058
SOMEONE PLZ HELP!!!!!!!!!
Answer:
Organelle :)
Explanation:
name one human hormone that is produced by genetically modified bacteria
Answer:
Insulin
Explanation:
I knew the answer, but I'm not really good at explaining these so I got a little help from google. -------- Bacterial cells can be genetically modified so that they have the gene for producing human insulin. As these modified bacteria grow, they produce human insulin.
Eukaryotic genomes have gene sequences that can code for more than one polypeptide sequence because _____.
Answer:
The correct answer would be -A pre-mRNA becomes mRNA by cutting out different introns
Explanation:
During the process of the RNA splicing, pre-mRNA has several specific segments of sequence that are identified by the spliceosome and then removed from the pre-mRNA. Specific parts that are removed are known as introns and the parts that stuck to become mRNA are exons.
Gene sequences in the eukaryotic genome can code for more than one protein due to removing the different introns every time to become mRNA from pre mRNA.
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answer:
what I don't understand what is the Ctcagt
Robert Hooke discovered cells in the 18th century.
true or false
Answer:
False it is in the 17th century (1665)
Explanation:
He named the little blocks after cells (little rooms)
List and describe the different types of connective tissue. What similarities and differences did you observe?
Answer:
There are three types of connective tissues, loose connective tissues, dense, and hyaline.
Explanation:
The difference between them is the composition of the extracellular matrix that surrounds the fibroblast, that is to say that in loose connective tissue, the function will be of support or filling, and the fibroblast is immersed in an extracellular matrix with a high content of water and proteins. collagen.
On the other hand, in dense connective tissue, the amount of collagen fibers is greater, the protein structure as well, and the interlacing between proteins is more complex, and they may also have the ability to calcify as in the case of bone tissue or cartilage.
Finally, we have the hyaline connective tissue, which is very rich in hyaluronic acid and is found in the joints forming the discs, which are shock absorbers and protectors from bone wear due to friction between surfaces, hyaluronic acid, proteinglycans and glycoproteins are the main protagonists of all connective tissues together with the fibroblast, but even more so in the hyaline connective.
please help me with this question:)
That is the nucleus!
Hope this helpeddd
Answer:nucleus :)
Explanation:
The creation of different breeds of dog by humans is an example of...
A) stabilizing selection
B) disruptive selection
C) artificial selection
D) sexual selection
Answer:
I believe it is artificial selection
Explanation:
i learned about this a little while ago lol
how did the settlers view panther when they came to north America
Answer:
They viewed the Panther with fear and set out on a mission to exterminate it.
Explanation:
The first Spanish conquistador to ever sight a Panther was Alvar Nunez Cabeza de Vaca in 1513. When he saw the panther which he referred to as a lion, he was fearful of the animal. He and other Europeans set out on a mission to exterminate all Panthers. This was also necessary as they had to clear the bushes for them to reside.
In 1821 when Florida officially became a part of the United States, and people had to relocate there, a $5 dollar bounty was placed on every Panther killed. The Panthers relocated farther into the wild. As of 1990, the population of the Panther was just around 50. Panthers have since been named an endangered species.
What do the dotted lines, indicated with the arrow, represent in the DNA model above?
The junctions of codons between individual strands
The bond between deoxyribose molecules and phosphates
The monomers that make up a polymer
The hydrogen bond between complimentary nucleotides
Answer:
The hydrogen bond between complimentary nucleotides.
The two kinds of cells are Prokaryotes and Eukaryotes. How are they
different? *
O Prokaryotes have a nucleus.
OEukaryotes have a nucleus.
O Prokaryotes are plant cells
оThere is no difference.
We find DNA on the ___, In every living cell that an organism owns
a. chromosomes
b. reproduction
c. mitosis
Answer:
A. Chromosomes
Explanation:
A Chromosome is some thing carrying genetic information in the form of genes.
We find DNA on the chromosomes, in every living cell that an organism owns. So, the correct option is A.
What is Chromosome?The word chromosome comes from the Greek words for color (chroma) and body (soma). Chromosomes are so named because they are cell structures, or bodies, that are strongly stained by certain color dyes used in research.
Chromosomes are defined as structures found inside the nucleus of a cell that are organized into genes from proteins and DNA. Each cell normally has 23 pairs of chromosomes.
These are threadlike structures which are made of protein and a single molecule of DNA that serve to carry the genomic information from cell to cell.
Therefore, the correct option is A.
Learn more about Chromosomes, here:
https://brainly.com/question/10234301
#SPJ6
One factor that determines the amount of oxygen transferred from the lungs to the blood is
the total functional surface area of the respiratory membrane.
O True
O False
Answer:
true
Explanation:
Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?
Answer:
i’d say mitochondria
Explanation:
mitochondria is the “powerhouse of the cell”
Which are properties of metals? Check all that apply
Dullness
Malleability
Ductility
Poor conductors of heat
Good conductors of heat
Answer:
2,3, and 5
Explanation:
got it right on edge
Sasha is studying a rock formation for her science class. Every few days she goes outside to study the formation. The questions she is
investigating are shown.
• Did the rock freeze and
unfreeze?
• Are there any plants growing on
the rock?
• Did the rock change color?
What question is Sasha most likely trying to answer?
O A. What is the age of the rocks in the rock formation?
B. What type of rocks are found in the rock formation?
C What processes are weathering the rock formation?
D. What minerals are the hardest in the rock formation?
Answer:
ill say c
Explanation:
A 67-year-old was previously diagnosed with rheumatic heart disease. Tests now reveal lipoprotein deposition with chronic inflammation that impairs blood flow from the left ventricle into the aorta. Which diagnosis does this history support?
Answer:
Aortic stenosis
Explanation:
Aortic stenosis is one of the most common cardiovascular diseases. This disease is caused by the narrowing of the aortic valve opening, thereby restricting blood flow from the left ventricle to the aorta. Symptoms of aortic stenosis include, among others, heart palpitations, swollen feet, chest pain, breathing difficulties, sleeping difficulties, chronic fatigue, etc. Aortic stenosis may be cured by transcatheter aortic valve replacement, which is a minimally invasive surgical technique that allows to replace the narrowed aortic valve.
How is the energy produced by respiration stored? (Googled answers will be reported) (actual answers please)
Answer: Energy is produced by respiration because its stored within the cells in the form of ATP (Adenosine Triphosphate) .
Explanation:
I'm pretty sure that's it.
- Sorry if I'm wrong :<
True or false?
An apple, potato, and onion all taste the same if you eat them with your nose plugged
Answer:
True
Explanation:
Answer:
True
Explanation:
It is frequently quoted that upwards of 80% of our taste is made up by smell. So if you plug your nose and cover your eyes, the taste between an apple and onion should be indistinguishable. Potato's will also taste the same .
Consider the food chain grasshopper mouse snakes hawks. If snakes go extinct what will happen to the food chain
Answer:
This can actually cause a major problem if the number of grasshoppers were to increase out of control. They eat plants and the number of plants,which are the basis of the food chain, could severely decrease which would impact all of the levels operating above this trophic level.
Answer:
Lack of mice
Explanation:
If the grasshopper where to go extinct the mice population would decrease. Which would lead to it being harder for snakes to find food or they would begin to rely on a different food source. But the hawks would be able to find less snakes but would overall be fine.
what makes stem cells different from cells in the body
Answer:
Stem cells are the body's raw materials
Explanation:
Stem cells are the body's raw materials — cells from which all other cells with specialized functions are generated. Under the right conditions in the body or a laboratory, stem cells divide to form more cells called daughter cells.
Stem cells are different from the other body cells as these are unspecialized cells which can undergo division and renew on their own. The stem cells can undergo specialization by the process of cellular differentiation.
What are Stem cells?Stem cells can be defined as the body's raw materials. These are the cells from which all the other cells with specialized functions are generated.
Embryonic stem cells are the pluripotent stem cells derived from the inner cell mass of a blastocyst. Blastocyst is an early-stage pre-implantation embryo. Human embryos reach the blastocyst stage in 4 to 5 days post fertilization, at which time they consist of 50 to 150 cells.
Stem cells are different from the other cells in the body in three ways which are the stem cells can divide and renew themselves over a long time. Stem cells are unspecialized cells, so they cannot do specific functions in the body unless they undergo cellular differentiation. Stem cells have the potential to become specialized cells, such as muscle cells, blood cells, and brain cells by undergoing cellular differentiation.
Learn more about Stem cells here:
https://brainly.com/question/25584485
#SPJ2
Which of the following is an example of evolution that can be studied firsthand by
scientists while it happens (meaning that scientists have opportunities to perform
experiments and to measure the outcome)?
A) The gradual decent of whales from tetrapod (four-legged) land mammal
ancestors
B) A dog shedding its thick winter fur so that it can stay cooler in the summer
C) The acclimation of a person's body to the low oxygen atmosphere at high
altitudes
D) The development of antibiotic resistance in bacteria
Answer:
c.
Explanation:
The acclimation of a persons body to the low oxygen atmosphere at high altitudes
In which form food is stored in the leaves? Comment
the answer is starch
Explanation:
food is stored in the leaf in form of starch in plants
which enzyme attaches the ozaki fragments?
Answer:
DNA ligase,joins the okazaki fragments together into a single DNA molecule
Answer:
DNA ligase attaches the ozaki fragments.
Explanation:
In my thought it's the answer.
Which phase of the Moon rises in the east as the Sun rises in the east
Answer:
Rise, Transit and Set time
Explanation:
What causes this change in fur color?