what is the name of the hormone that promotes the production of follicles in the ovary?
A-ADH
B-FSH
C-LH
D-TSH​

Answers

Answer 1

B-FSH he hormone responsible for starting follicle development and causing the level of estrogen to rise.

Answer 2

Answer:

B

Explanation:

FSH helps mature the follicles, and LH helps stop the phase of ovulation so that next step can occur


Related Questions

in developing countries, which of the following is predicted to happen to both population and demand for meat and milk?

A. it will double by 2050
B. it will decrease by 2050
C. it will stay the same in 2050
D. it will increase slightly by 2050​

Answers

number c is the answer

How do invasive species usually affect the availability of natural resources in an ecosystem?

PLEASE HELP ME​

Answers

Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

Explanation:

Both Mrs. Smith and Mrs. Jones had babies the same day in the same hospital. Mrs. Smith took home a baby girl named Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect, however, that her baby had been accidently been switched with the Smith baby in the nursery. Blood tests were made. Mr. Smith was blood type A, Mrs. Smith was type B, Mr. Jones was type A, Mrs. Jones was type A. Shirley was type O, and Jane was type B. Had a mix-up occurred? SHOW WORK!

Answers

Answer:

yes a mixup had occured because two A blood types would result in a baby with the same blood unle mr.jones wasnt the father

Explanation:

Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver​

Answers

Answer:

The pancreas

Explanation:

it happens when the pancreas doesnt produce enough of something called insulin

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%

Answers

Answer:

90%

Explanation:

As a discussed in the lesson, eukaryotic cels are differ from prokaryotic cells based on what three things?

Answers

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions

Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids

Answers

Answer:

The correct answer is - proteins.

Explanation:

All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.

Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.

How many hydrogen bonds are present in the base pairing of guanine and cytosine?
3

Answers

Answer:

3 Hydrogen bonds

Explanation:

Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds.

how does a liver cell respond to insulin

Answers

Answer:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Explanation:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

In pea plants, purple flowers (P) are dominant over white flowers (P). If two heterozygous purple flowered plants are
crossed with each other, then what are the possible genotypes of the offspring?
0
Answer is pp only

Answers

Answer :the answer is D

Explanation:

You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele

Answers

Answer:

Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )

Explanation:

The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.

The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ).  hence option D is the correct answer.

helpppp I’ll do anything BUT I HATE links so please NO links

Answers

Mitochondria: supplies energy to the cell

Nucleus: Control center of the cell; contains DNA

Ribosomes: makes proteins inside cell

Cell membrane: protective layer of the cell

Hope this helps :)

Mitochondria: source of energy to cell

Nucleus: contains dna and controls center

Ribosomes: produces protein

Cell membrane: gives protection

Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.

Answers

Answer:

Liver phosphorylase a concentration decreases when glucose enters the blood.

The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form

As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form

Explanation:

Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.  

Which of the following fresh water biomes consists of moving water

Answers

Answer:

Biomes consists of moving water is estuaries.

extrusive rocks have larger grains than intrusive rocks.true or false and why

Answers

False because extrusive rocks have fine-grained texture due to the rapid cooling of magna above the earth surface. On the other hand extrusive rocks have course grained texture due to slow cooling of magna beneath the Earth's surface


Please help, A, B,C, or D?

Answers

Answer:

I cant see the pic??

Explanation:

Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree

Answers

Answer:

D

Explanation:

The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria

I think it’s a calibrator but I’m not 100% sure he might be right it could be D

I need help ASAP!!
A.D
B.B
C.C
D.A

Answers

Answer:

a ibecause tifmsndtbeekodfhekekn

the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles​

Answers

the answer to the question is c

Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks

Answers

Answer:

Bacteria

Explanation:

Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.

Sunlight, rocks, and soil are all non-living.

The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.

They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.

Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.

Learn more about  soil  at:

https://brainly.com/question/31227835

#SPJ6

What are examples of convections currents? What are examples of convection currents? A: the movement of war air into cooler air and cooler air into warmer air B: the movement of cool water into warmer water and warmer water into cool water. C: the displacement of air/water molecules by other air/water molecules due to varying temperatures. D: all of the above

Answers

Answer:

C: the displacement of air/water molecules by other air/water molecules due to varying temperatures

Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.

Answers

A. He crossed true-breeding pea plants

The research practices Mendel used is applies including A, B and C.

What is Mendel's experiment?

Mendel studied inheritance in peas (Pisum sativum). He chose peas because pea plant are easy to grow and can be sown each year. Pea flowers contain both male and female parts, called stamen and stigma, and can usually self-pollinate.

Mendel studied the inheritance of 7 traits in pea plants including height, flower color, seed color, and seed shape and each trait had 2 forms. He identified pure-breeding pea plants that consistently showed 1 form of a trait after generations of self-pollination.

Mendel proposed a theory of inheritance, based upon the observed data during his experiments, and a mathematical analysis of his results,

Thus, from above, the correct options include A, B and C whereas D doesnt apply because Mendel studied 7 traits at a time.

Learn more about Mendel' experiment, here; https://brainly.com/question/3056662

#SPJ2

Describe the steps a plant would take to move sugars from a source to a sink.

Answers

sugars are transported through the phloem, from sources to sinks, is called pressure flow. At the sources (usually the leaves), sugar molecules are moved into the sieve elements (phloem cells) through active transport.

The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it

Answers

Answer:

A) make new cells(somatic cells)and only germ-line cells do it(meiosis)

Explanation:

Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.

While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.

Meiosis produces germ cells while mitosis produces somatic cells.

What is the major distinction scientists use to divide the animal kingdom?

Answers

Answer:

Whether the animal has a vertebral column or not.

How can a small mutation provide a small advantage to an organism?

Answers

Answer:

It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.

Hope this helps!

What is the formula to find out the energy when given the energy?

Answers

2
KE=0.5×m×v
2
I think

answer and show proof for brainliest

Answers

Answer:

C- South America. Because South America is mostly rain forest and forests in the northern and mid section of it.

Explanation:

what does the tilde symbol mean in biology

Answers

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".

Other Questions
How did the eastern question affect the austro hungrarian empire? A farmer is building a fence to enclose a rectangular area against an existing wall. Three of the sides will require fencing and the fourth side is a wall that already exists. If the farmer has 148 feet of fencing, what is the largest area the farmer can enclose? Helpppppppp plsss ASAP math look at picture for details a person who is at least 65 years old is considered a senior citizen write an inequality that represents this situation. Let a represent the persons age Part A: Create an example of a polynomial in standard form. How do you know it is in standard form? (5 points)Part B: Explain the closure property as it relates to polynomials. Give an example. (5 points) What should you do if you think you have broken your sternum (This is not a homework question) I need an Answer. ASAP (It's a bit paining for me too and also pls tell me how to control the pain) 3V360Find the values of x and y. Write your answers in simplest form.X=y= The genetic code is:*Choose all that applyGroup of answer choicesredundant, with more than one codon for some amino acids.uambiguous in that any codon for one amino acid does not code for any other amino acid.nearly universalthe genetic code is shared by organisms from the simplest bacteria to the most complex plants and animalswithout punctuation in that codons are adjacent to each other with no gaps in between PLEASE HELP WILL MARK BRAINLIEST True or False? Nathalie is disappointed that Ins' brother is getting married. What would be an example of the pathway a plastic bag thrown on the ground in eastern Washington could end up in the Pacific Ocean? Which Chinese invention is still used for recording and transmitting the written word The painting shown at the right has an area of 220. What is the value of x? How many cubic feet of water are in the pool? Which of the following is equal to 49x281?(7x9)2(x+9)(x9)(7x+9)(7x9)(7x+9)2 Mexican dictator Porfirio Diaz inspired a revolution in 1910 by using his power tolimit democracy and freedoms.limit the church and the wealthy.expand democracy and freedoms.expand liberal reforms and rights. A statement and a proposed negation are given below. Statement: The product of any irrational number and any rational number is irrational. Proposed negation: The product of any irrational number and any rational number is rational. Which of the following correctly describes the relation between the statement and the proposed negation? The proposed negation is correct. The proposed negation is not correct. A possible correct negation would be: There is not an irrational number and a rational number whose product is rational. The proposed negation is not correct. A possible correct negation would be: There does not exist an irrational product of any irrational number and any rational number. The proposed negation is not correct. A possible correct negation would be: There is an irrational number and a rational number whose product is rational. The proposed negation is not correct. A possible correct negation would be: There exists an irrational product of an irrational number and a rational number. PLZ ANSWER NO FAKE LINKS OR SAYING I READY ISNT ALLOWED X = y - 32x + y = 12pls hurry i need badly A dollar store sells items for $1 and $2. You plan to go there and spend at least $20. Let x stand for the number of one-dollar items and let y stand for the number of two-dollar items. Write and graph a linear inequality that models the situation.