What is the nth term rule of the linear sequence -5,-7,-9,-11,-13

Answers

Answer 1

Answer:

-7

Step-by-step explanation:

cause I took the test and got it right in my first try

Answer 2
Your rule for the sequence is -2n-3. Substitute any value for n and you will get the input. Hopefully this helps

Related Questions

[tex]\sqrt{25-10\sqrt{3}+3 }[/tex]

Answers

Here is your answer: )

What is the simplest radical form of the expression?
(8x^7y^4)^2/3

Answers

Answer:

[tex]4x^4y^2\sqrt[3]{x^2y^2}[/tex]

Step-by-step explanation:

Recall that [tex]a^{(\frac{b}{c})}=\sqrt[c]{a^b}[/tex].

Therefore, we have:

[tex](8x^7y^4)^{\frac{2}{3}}=\sqrt[3]{(8x^7y^4)^2}[/tex]

Use the exponent property [tex](a^b)^c=a^{(b\cdot c)}[/tex] to simplify:

[tex](8x^7y^4)^{\frac{2}{3}}=\sqrt[3]{(8x^7y^4)^2}=\sqrt[3]{64x^{14}y^8}=\boxed{4x^4y^2\sqrt[3]{x^2y^2}}[/tex]

The radius of a circle is 2 meters. What is the area of a sector bounded by a 135 degree arc? Give the exact answer in simplest form

Answers

Answer:

Area of circle bounded by a 135 ° arc is 4.71 m ²

Step-by-step explanation:

Given that :-

Radius of circle, r = 2 m

Angle of the circle , θ = 135 °

To Find :-

Area of circle bounded by a 135 ° arc.

Solution :-

Using Formula

Area of circle = θ/ 360 × π × r ²

substitute the values,

Area of circle = 135 /360 × 3.14 × ( 2 m) ²

solve it

Area = 27 / 72 × 3.14 × 4 m ²

Area = 27 / 18 × 3.14

Area = 1.5 × 3.14

Area = 4.71 m ²

Therefore, Area of circle bounded by a 135 ° arc is 4.71 m ²

Answer:

it's 3/2pi

Step-by-step explanation:

.

BRAINLIEST PLEASE HELP!
Write the standard equation for the circle center (-6 -8) that passes through (0 0)

Answers

Answer:

(x + 6)² + (y + 8)² = 100

Step-by-step explanation:

The standard equation for a circle is (x - a)² + (y - b)² = r²

If you find the r² of this circle, you will get 100, and there's just one equation with 100

Three friends go to the movies and spend a total of $75.00. Each friend bought a ticket and a small popcorn that cost $8.25 how much was each ticket

Answers

Given:

Total amount spend on movie = $75

Each friend bought a ticket and a small popcorn that cost $8.25.

To find:

The price of each ticket.

Solution:

Let x be the price of each ticket.

Total cost of ticket and popcorn of each friend [tex]=x+8.25[/tex]

Total cost of ticket and popcorn of three friend [tex]=3(x+8.25)[/tex]

It is given that, the total amount spend on movie is $75. So,

[tex]3(x+8.25)=75[/tex]

[tex]x+8.25=\dfrac{75}{3}[/tex]

[tex]x+8.25=25[/tex]

Subtract 8.25 from both sides.

[tex]x=25-8.25[/tex]

[tex]x=16.75[/tex]

Therefore, the cost of each movie ticket is $16.75.

Help



Will


Give BRIANLIST

Answers

Answer:

area of the figure=length×width

=6(X+6)

=6x+36 sq feet

answer is the second option

Answer:

B is the answer. This gives us the equation 6(x+6), where we multiply 6 by both values inside the equation. 6x + 36 is the answer. Happy learning!

Happy learning!

--Applepi101

Find x. Round to the nearest degree.

Answers

Answer:  56 degrees approximately

==========================================

Work Shown:

tan(angle) = opposite/adjacent

tan(x) = 15/10

tan(x) = 1.5

x = arctan(1.5)

x = 56.3099 approximately

x = 56 degrees

Note: arctan is the same as inverse tangent

A woman received 5 per cent interest on a loan of $300 for 1 year. How much interest did she receive? $5 $15 $30 $150 none of these

Answers

Answer:

15$

Step-by-step explanation:

this is because if you use our formula of I= prt

we can substitute our varibles for our equation

I= 300 x 0.05 x 1

we turn 5 in 0.05 to represent out rate, due to this our rate would have to be Simplified into a percent then a decimal

after this if we now proceed through our equation we will get

I = 300 x 0.05 x 1

I = 15

Find measure of angles B, E, D and C and the length of BC.

Triangle ABC ~ Triangle DEF. Measure of angle A = 30 degrees and measure of angle F = 65 degrees. AB=20, DE = 35, EF= 28.

Answers

Answer:

< B = 180-30-65=85°

< E = 85°

< D = 30°

< C = 65°

BC = 20/35 × 28 = 16

Answer:

<D = 30

< C = 65

<B = <E = 85

16 = BC

Step-by-step explanation:

ABC ~ Triangle DEF

<A = <D = 30

< C = <F = 65

Since they are similar triangles

A+ C + B = 180 since the angles of a triangle = 180

30+65+B =180

95+ B = 180

<B = 180 -95 = 85

<B = <E = 85

The triangles are similar so the sides are proportional

AB      BC

----  = ---------

DE      EF

20      BC

----  = ---------

35      28

Using cross products

20*28 = 35 BC

Divide each side by 35

20*28/35 = 35/35 BC

16 = BC

9. A sector of a circle has central angle
[tex] \frac{\pi }{4} [/tex]
and area
[tex] \frac{49\pi}{8} [/tex]

[tex] {cm}^{2} [/tex]
. Find the radius of the circle​

Answers

Answer:

Step-by-step explanation:

Begin with the formula for the area of a sector:

[tex]A=\frac{\theta}{2\pi}*\pi r^2[/tex] and we are given everything except the radius, r. Filling in what we know:

[tex]\frac{49\pi}{8}=\frac{\frac{\pi}{4} }{2\pi}*\pi r^2[/tex] and then start the simplification process. I began by dealing with the fraction over a fraction thing, which simplifies the equation to:

[tex]\frac{49\pi}{8}=\frac{1}{8}\pi r^2[/tex] then isolate the r-squared:

[tex]\frac{8(49\pi)}{8\pi}=r^2[/tex]. Canceling out the π's and the 8's leaves us with simply

r² = 49 so

r = 7

What is the equation of the line that passes through the point (4, -2) and has a slope of -2???

Answers

Answer:

.

Step-by-step explanation:

Answer:

y=mx+c

Step-by-step explanation:

Tony runs to keep fit ,he wants to run a total of 20 km each week. Here are the distance tony ran last week 7.75km 5km 750m 61\2 km did tony run 20 km last week?

Answers

Answer:

yes

Step-by-step explanation:

Add all the distances ran last week

7.75

+

5km

+

0.75 (1000m = 1km) 750 / 1000 = 0.75km

+ 6.5

= 20 km

6. Find the function with x-intercepts (-3,0) and (5,0), which also goes through the point (1,8)

Answers

Answer:

f(x) = (-1/2)(x^2 + 8x - 15)

Step-by-step explanation:

This function has two roots:  -3 and 5.  Most likely it is a quadratic (all of which have two roots).

Then f(x) = a(x + 3)(x - 5)

The graph goes through (1. 8):  Therefore, y = 8 when x = 1:

f(1) = a(1 + 3)(1 - 5) = 8, or

        a(4)(-4) = 8, or

            -16a = 8, which leads to a = -1/2.

Thus the quadratic in question is f(x) = (-1/2)(x + 3)(x - 5), or

                                                        f(x) = (-1/2)(x^2 + 8x - 15)

The function is a quadratic function given by f(x) = (-1/2)(x + 3)(x - 5) and f(x) = (-1/2)(x² + 8x - 15).

What is a Function?

A function is a law that relates a dependent and an independent variable.

The function has x-intercepts at (-3,0) and (5,0),

The function  has two roots:  -3 and 5

So, the equation is a quadratic equation represented by

f(x) = a(x + 3)(x - 5)

The function goes through the point (1. 8)

y = 8 when x = 1

f(1) = a(1 + 3)(1 - 5) = 8

-16a = 8,

a = (-1/2)

f(x) = (-1/2)(x + 3)(x - 5)

f(x) = (-1/2)(x² + 8x - 15)

To know more about Function

https://brainly.com/question/12431044

#SPJ5

Anyone know the answer ?

Answers

Answer:

is the name of your school alpha omega, because i recogize the bottom of the page

Step-by-step explanation:

A shirt originally $38.00 is on sale for 25% off. What is the discounted price?

Answers

Step-by-step explanation:

$ 28.50

minus $ 0.00

FINAL Price » $ 28.50

Note: Sales Tax Not Included

Savings » $ 9.50

Effective % Off » 25%

Answer:

$28.5

Step-by-step explanation:

100% - 25% = 75% (so you don't have to add or subtract anything)

38 * .75 = 28.5

=$28.5

the ratio of berries to oranges is 10:1
If they are 25 oranges how many berries are there?​

Answers

Answer:

250

Step-by-step explanation:

create a proportion based on 10 berries to every one orange:

let 'b' = # berries

10/1 = b/25

cross-multiply to get:

b = 10(25)

b = 250

WILL


GIVE


BRAINLIST



Solve

EIGHT TIMES a number, added to 4, is -4. Find the number

Answers

Answer:

The number is -1.

Step-by-step explanation:

Set up an equation:

Variable n = number

8 × n + 4 = -4

Use PEMDAS

8n + 4 = -4

Isolate the variable:

8n = -8

n = -1

Check your work:

8 × -1 + 4 = -4

-8 + 4 = -4

-4 = -4

Correct!

Answer:

-1

Step-by-step explanation:

Write out the equation in numbers.

1. Eight times a number = 8x

2. Added to four = +4

3. Is -4 = =-4

4. Now put it together- 8x + 4 = -4

5. Subtract 4 from each side- 8x = -8

6. Divide both sides by 8- x = -1

Please please help me

Answers

Answer:

The perimeter of the figure will be 62.8 or B

Step-by-step explanation:

1) The radius is 10

2) Perimeter basically means circumference

3) The formula for circumference is 2πr

4) 2π*10

5)2*pi=6.28*10=62.8

can someone pls help for brainlest

Answers

Answer:

270

Step-by-step explanation:

24 times 30, divided by 2 (360)

then subtract 12 times 15 divided by 2 (90)

Plz Help! Ill give brainiest to whoever answers!!!

Answers

1. 54

2. 63.5

3. 23

4. 1.80125

Answer: Just find the mean by using math

Step-by-step explanation:

Clara solved the equation
7
3
x = −
2
3

Answers

Answer:

hope it is helpful to you

hey pls help asap
it's urgent due within 1 hr​

Answers

Answer:

I.       C. Both A and B

II.      D. All of the options

III.     B. Help in making people a valuable resource

. If one of the zeroes of the quadratic polynomial (k-1) x2 +k x +1 is -3 then what is the value of k?

Answers

Answer:

k = 1¹/₃

Step-by-step explanation:

Comparing (k-1)x² + kx + 1 with ax + bx + c where α, β be the zeroes of the quadratic equation, then

α + β = -b/a = -k/(k - 1) and αβ = c/a = 1/(k - 1)

Since one of the zeros is -3, β = -3

So,

α + β = -k/(k - 1)

α + (-3) = -k/(k - 1)

α - 3 = -k/(k - 1)  (1)

and

αβ = 1/(k - 1)

-3α = 1/(k - 1)    (2)

From (1), α = 3 - k/(k - 1)  (3)

Substituting equation (3) into (2), we have

-3α = 1/(k - 1)

-3[3 - k/(k - 1)] = 1/(k - 1)

-9 + 3k/(k - 1) = 1/(k - 1)

-9 = 1/(k - 1) - 3k/(k - 1)

-9 = (1 - 3k)/(k - 1)

cross-multiplying, we have

-9(k - 1) = 1 - 3k

expanding the brackets, we have

-9k + 9 = 1 - 3k

collecting like terms, we have

-9k + 3k = 1 - 9

-6k = -8

dividing through by -6, we have

k = -8/-6

k = 4/3

k = 1¹/₃

Solve x2 + 8x + 7 = 0 by completing the square. Which equation is used in the process?

Answers

Answer: x = -1, -7

Step-by-step explanation:

I used internet

Answer:

x = -1   or   x = -7

Step-by-step explanation:

x^2 + 8x + 7 = 0

x^2 + 8x + ____ = -7 + ____

To complete the square, we add the square of half of the x-term coefficient to both sides.

x-term coefficient: 8

half of it: 4

square it: 4^2 = 16

We add 16 to both sides.

x^2 + 8x + 16 = -7 + 16

(x + 4)^2 = 9

x + 4 = +/- sqrt(9)

x + 4 = 3   or   x + 4 = -3

x = -1   or   x = -7

3x=1/81 what is the value of x?​

Answers

Answer:

hello

3x = 1/81

x = 1/ 81*3

x = 1/243

Step-by-step explanation:

Answer:

x=(1/81)/3

x=1/243

Step-by-step explanation:

can someone help me please with solution

Answers

could you upload another picture?

PLEASE HELP ME WITH THIS QUESTION AND SHOW YOUR WORK

Answers

Try it and see look In the corner

Ms. Li opened a retirement account with adeposit of $2,500. This account earns 4% simple interest annually. How many years will it take her to earn $500 on her $2,500 deposit?

Answers

Answer:

5 years

Step-by-step explanation:

Use the simple interest formula: I = prt

Plug in 500 as I, since that is the amount of interest being earned.

Plug in 2,500 as P and 1.04 as r.

I = prt

500 = (2,500)(0.04)t

500 = 100t

5 = t

So, it will take 5 years to earn $500 on the deposit.

Your mother buys a new mirror for your home. It has a radius of 32.5 centimeters

Using the formula: C= (pi) x d

What is the circumference of the mirror?

Answers

297.23 is the answer

Question 3 Look at the diagram below. If XY = 7 and XZ = 30, what is the value of t? 7 2t - 1 X Y Z​

Answers

Answer:

Step-by-step explanation:

go to brainly.com

Other Questions
please help thank youuuu Please help I will give you Brainlyest HelpHelpHelpHelpHelpHelp Write two simple sentences about education a/ one sentence using one subject and two verbs b/ one sentence using two subjects and two verbs Peter work three more days than jill. Peter earn $20 day jill earn $40 day. But they earned the same amount of money Which of the following is an equivalent trig ratio for tan 28Cos 621/ tan 621/ tan152Cos 28 The answer choices are spelling rules about what to do before adding suffixes to a base word that ends in a consonant. Identify the rule that was applied to the word below.benefit + -ingDo not double the final consonant if the suffix begins with a consonant.If a base word has three or more syllables, do not double the final consonant.If a base word ending in one consonant has two syllables, and the second syllable gets the accent, double the final consonant.If a base word ends in more than one consonant, just add the suffix without changes.If a base word has only one syllable and ends in one consonant, double the final consonant.If a base word ending in one consonant has two syllables, and the first syllable gets the accent, do not double the final consonant. two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?A whether the producers are located on land or in waterB whether or not the food web includes tertiary consumersC whether the web includes animals that migrate during the yearD whether the ecosystem described by the web is localized or very broad two particles woth each charge magnitude 2.010^-7 c but opposite signs are held 15cm apart.what are the magnitude and direction of the electric field E at tge point midway between charges Subordinate Conjunctions make a _______ clause not be able to stand on its own. PLEASE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP please help please help the tRNA for GUCAUCGAUCGAUCGGAUGCC A red light flashes every 6 seconds A yellow light flashes every 4 seconds They both flash at the same time.After how many seconds will they next both flash at the same time? The radius of a right circular cone is increasing at a rate of 1.1 in/s while its height is decreasing at a rate of 2.6 in/s. At what rate is the volume of the cone changing when the radius is 107 in. and the height is 151 in. The elements in a long array of integers are roughly sorted in decreasing order. No more than 5 percent of the elements are out of order. Which of the following is the best method to use to sort the array in descending order?I. Insertion sort.Il. Merge Sort.III. Heap Sort.a. Ill only.b. I only.c. II and III only.d. I and II only.e. Il only I and.f. Ill only. Help please I asp !!! For A = R + PRT/100 make P the subject. 1. What are metabolic wastes?2. Which are the main organs of the excretory system? please help me with this The practice of selling indulgences troubled many Catholics because the practice made it seem like?