What is the perimeter of Quadrilateral ABCDwith vertices at A(−11, −6), B(−3, 0), C(1, 0), and D(1, −6)?

Answers

Answer 1

Answer:

32 units

Step-by-step explanation:

the perimeter =

(1 -(-3)) +(0-(-6)) + (1 -(-11) + (√(12-4)²+6²)

= (1+3) +(0+6) +(1+11) +(√(64+36))

= 4+6+12 + 10

=32 units


Related Questions

Find the surface area of a square pyramid with side length 4 yd and slant height 6 yd.

Answers

Answer:

112 yd²

Step-by-step explanation:

Surface area of the square pyramid = area of base + perimeter of base × slant height

Area of base = s²

s = 4 yd

Area = 4² = 16 yd²

Perimeter = 4(s)

Perimeter = 4(4) = 16 yd

Slant height = 6 yd

Surface area of the square pyramid = 16 + 16 × 6

= 16 + 96

= 112 yd²

What are the domain and range of this function?

Answers

Answer: Choice DDomain: all real numbersRange: [tex]y \ge 1[/tex]

===========================================

Explanation:

The domain is the set of allowed x inputs. We can plug in any x value we want as the graph stretches on forever to the left and to the right. There aren't any division by zero errors or any issues like that to worry about, so that's why we don't kick out any x values from the domain.

The domain being all real numbers translates to the interval notation [tex](-\infty, \infty)[/tex] which is basically saying [tex]-\infty < x < \infty[/tex]

-----------------------------------

The range is the set of y outputs possible. The graph shows that y = 1 is the smallest y output, so y = 1 or y can be greater than this.

In short, [tex]y \ge 1[/tex] is the range which converts to the interval notation [tex][1, \infty)[/tex] which is the same as saying [tex]1 \le y < \infty[/tex]

-----------------------------------

Extra info:

The equation of this absolute value function is y = |x|+1

How long is 20 yards?

A. 600 in.
B. 720 in.
C. 840 in.
D. 900 in.

Answers

Answer:

B) 720 in

Step-by-step explanation:

1 yard is equal to 36 inches.

So, we just have to multiply 20 by 36:

20 × 36 = 720

20 yards is 720 inches.

The answer is B. 720 in.

What is the interest on a loan of $7,850 that is borrowed at 6.55% for 18 months?

Answers

Answer:

[tex]{ \tt{simple \: interest = }} \\ { \tt principle \times rate \times period}\\ \\ = 7850 \times 6.55\% \times 18 \\ { \tt{interest = 925515 \: dollars}}[/tex]

Answer:

$925,515

Step-by-step explanation:

multiply 7850 by 131/ 20 because 6.55 as a fraction is 131/20 and then multiply it by 18 and divide it by 20 which is the denominator of 131/20

What value of x is in the solution set of 8x – 6 > 12 + 2x? ​

Answers

Answer:

x  > 3

Step-by-step explanation:

[tex]8x - 6 > 12 + 2x\\\\8x - 6 + 6 > 12 + 6 + 2x\\\\8x > 18 + 2x\\\\8x - 2x > 18 +2x-2x\\\\6x > 18\\\\\frac{6x>18}{6}\\\\\boxed{x > 3}[/tex]

Any value that is greater than 3 would be in the solution set for the inequality.

Hope this helps.

Answer:

x > 3

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Equality Properties

Multiplication Property of Equality Division Property of Equality Addition Property of Equality Subtraction Property of Equality

Algebra I

Terms/Coefficients

Step-by-step explanation:

Step 1: Define

Identify

8x - 6 > 12 + 2x

Step 2: Solve for x

[Subtraction Property of Equality] Subtract 2x on both sides:                      6x - 6 > 12[Addition Property of Equality] Add 6 on both sides:                                     6x > 18[Division Property of Equality] Divide 6 on both sides:                                  x > 3

Find the limit of the function by using direct substitution Lim x-0(x^2+10)

Answers

9514 1404 393

Answer:

  10

Step-by-step explanation:

Maybe you want ...

  [tex]\displaystyle\lim_{x\to 0}(x^2+10)=0^2+10=\boxed{10}[/tex]

translate into algebraic expression " the sum of five times m and n​

Answers

Explanation:
"Five times" means
5
(
...
)
,
"the sum of a number, say
x
, and

3
", means"{(x+(-3)}=(x-3)#.
Taking all these together, the reqd. Algebraic Expression turns out to be
5
(
x

3
)
.

Solve the inequality 5u≤8u−21 and write the solution in interval notation

Answers

Answer:

Step-by-step explanation:

[tex]5u\leq 8u-21[/tex]

Subtract 8u from both sides

[tex]-3u\leq -21[/tex]

Divide by -3 on both sides

[tex]u\geq 7[/tex]

Interval notation: [greater/less than or equal to], (greater or equal to)

[7,∞)

The solution to the inequality is u ≥ 7, which means that u is greater than or equal to 7. In interval notation [ 7, ∞).

What is inequality?

In mathematics, an inequality is a remark that two values or expressions are not equal. An inequality uses one of the comparison symbols: "<" (less than), ">" (greater than), "≤" (less than or equal to), "≥" (greater than or equal to), or "≠" (not equal to).

Here,

To solve the inequality 5u ≤ 8u - 21, we can start by isolating u on one side of the inequality. We can do this by subtracting 5u from both sides:

5u ≤ 8u - 21

-3u ≤ -21

Divide both sides by -3. Note that dividing by a negative number will reverse the direction of the inequality:

u ≥ 7

Therefore, the solution to the inequality is u ≥ 7, which means that u is greater than or equal to 7. In interval notation [ 7, ∞).

Learn more about inequality here:

brainly.com/question/14098842

#SPJ2

What is the value of this number in decimal form?
Five and three hundred eight thousandths.

Answers

5.308 would be the correct answer

Which is a possible turning point for the continuous
function f(x)?

Answers

Step-by-step explanation:

Since we know that the function of the graph is continuous, then (-2, -1) is the most likely turning point because at this point the function stops increasing and starts decreasing.

please help i suck at math and i really need help i do anything just help


Emma and Zeke own an on-line business, EZ Coasters, that sells cork beverage coasters, which can be bought plain or with logos. The price for both types of coasters is $3.00 each. There is also a one-time set-up charge of $25 for coasters with a logo.


1) Write an equation describing the relationship between:
a) The number of plain coasters bought and the cost of the coasters.

b) The number of coasters with a logo bought and the price of the coasters.

c) Is either coaster relationship proportional? Explain in writing how you know.

d) Explain what the unit rate of the line described by each equation means in the context of the coasters.

2) EZ Sales also sells plain natural sandstone coasters for $4.00 each.
a) Write the equation describing this relationship.
b) Indicate whether or not it is a proportional relationship and explain why?
c) Will the graph of this equation ever intersect the graph of the equations for either of the other two EZ Coasters? Explain in typing how you made your decision.

Answers

Answer:

a

Step-by-step explanation:

The slope-intercept form of the equation of a line that passes through point (–3, 8) is y = –y minus 3 equals negative StartFraction 2 Over 3 EndFraction left-parenthesis x plus 8 right-parenthesis.x + 6. What is the point-slope form of the equation for this line?

y – 3 = –StartFraction 8 Over 5 EndFraction x plus StartFraction 2 Over 3 EndFraction equals StartFraction one-half EndFraction minus StartFraction 1 Over 5 EndFraction x.(x + 8)
y + 3 = –y plus 3 equals negative StartFraction 2 Over 3 EndFraction left-parenthesis x minus 8 right-parenthesis.(x – 8)
y + 8 = –y plus 8 equals negative StartFraction 2 Over 3 EndFraction left-parenthesis x minus 3 right-parenthesis.(x – 3)
y – 8 = –y minus 8 equals negative StartFraction 2 Over 3 EndFraction left-parenthesis x plus 3 right-parenthesis.(x + 3)

Answers

D. y – 8 = –y minus 8 equals negative Start Fraction 2 Over 3 End Fraction left-parenthesis x plus 3 right-parenthesis.(x + 3)

Step-by-step explanation:

I took the test and got it right

Answer:

its D just did the test on edge

Step-by-step explanation:

You measure 34 textbooks' weights, and find they have a mean weight of 69 ounces. Assume the population standard deviation is 8.2 ounces. Based on this, construct a 95% confidence interval for the true population mean textbook weight. Give your answers as decimals, to two places

Answers

Answer:

The 95% confidence interval for the true population mean textbook weight is between 66.24 and 71.76 ounces.

Step-by-step explanation:

We have that to find our [tex]\alpha[/tex] level, that is the subtraction of 1 by the confidence interval divided by 2. So:

[tex]\alpha = \frac{1 - 0.95}{2} = 0.025[/tex]

Now, we have to find z in the Z-table as such z has a p-value of [tex]1 - \alpha[/tex].

That is z with a pvalue of [tex]1 - 0.025 = 0.975[/tex], so Z = 1.96.

Now, find the margin of error M as such

[tex]M = z\frac{\sigma}{\sqrt{n}}[/tex]

In which [tex]\sigma[/tex] is the standard deviation of the population and n is the size of the sample.

[tex]M = 1.96\frac{8.2}{\sqrt{34}} = 2.76[/tex]

The lower end of the interval is the sample mean subtracted by M. So it is 69 - 2.76 = 66.24 ounces

The upper end of the interval is the sample mean added to M. So it is 69 + 2.76 = 71.76 ounces.

The 95% confidence interval for the true population mean textbook weight is between 66.24 and 71.76 ounces.

Faith has some coins in two different pockets. The shaded areas in the diagrams below represent the value of the coins in each pocket.

What is the total value, in dollars, of the coins that Faith has in both pockets?​

Answers

Answer:

$3.05

Step-by-step explanation:

Each box is $0.05

The shades boxes represent the value of coin in each pocket :

Number of shaded boxes on the left = 24

Value of coins in left pocket = 24 * $0.05 = $1.2

Number of shaded boxes on the right = 37

Value of coins in right pocket = 37 * $0.05 = $1.85

Tital value if coins :

$1.85 + $1.2

= $3.05

Lighter cars are more fuel-efficient than heavier cars. An environmentalist would like to estimate the true mean weight
of all cars. To do so, she selects a random sample of 30 cars and determines the 90% confidence interval for the true
mean weight to be 2.8 to 3.4 tons. Which of these statements is a correct interpretation of the confidence level?
O There is a probability of 0.90 that the confidence
interval (2.8, 3.4) captures the true mean weight of all cars.
O The environmentalist can be 90% confident that the true mean weight of all cars is between 2.8 and 3.4 tons,
O If many random samples of size 30 are selected from the population of all cars, approximately 90% of the sample
means will be between 2.8 and 3.4 tons.
O If many random samples of size 30 are selected from the population of all cars, about 90% of the intervals would
capture the true mean weight of all cars.

Answers

Answer:

The environmentalist can be 90% confident that the true mean weight of all cars is between 2.8 and 3.4 tons.

Step-by-step explanation:

x% confidence interval:

A confidence interval is built from a sample, has bounds a and b, and has a confidence level of x%. It means that we are x% confident that the population mean is between a and b.

In this question:

90% confidence interval between 2.8 and 3.4 tons. This means that the environmentalist can be 90% sure that the mean weight of all cars is in this interval, that is:

The environmentalist can be 90% confident that the true mean weight of all cars is between 2.8 and 3.4 tons.

Gianna brought seven necklaces for $50.75 and Winnie brought three necklaces for $24.60 who got the better deal

Answers

Gianna paid less per necklace so she got the better deal

Gianna: 50.75 / 7 = 7.25
So she paid $7.25 per necklace
Winnie: 24.60 / 3 = 8.20
So she paid $8.20 per necklace

what’s the length of the middle segment ?

Answers

Answer:

AB = 15

Step-by-step explanation:

I am assuming this is a trapezoid. The length of the mid-segment of a trapezoid can be found by taking the average of the two parallel sides, in this case, VW and UX.

The average is found by adding the total values and dividing by the number of values, which in this case, is 2.

9+21 = 30

30/2 = 15

AB = 15

Find the volume of the prism.
8 cm
12 cm
6 cm

Answers

Area of base triangle = 1/2×base×height

Area of base= 8×6×1/2= 24cm²

Area of prism = Bh = 24 × 12 = 288cm³

Answer:

Solution given:

base[b]=6cm

height [h]=8cm

length[l]=12cm

volume of a prism=area of triangle *length

=½*b*h*l=½*6*8*12=288cm³

is a required answer.

Multiply this please

Answers

Answer:

-70x² + 49x - 63

Step-by-step explanation:

7( -10x² + 7x - 9) =

7( -10x²) + 7(7x) - 7(9) =

-70x² + 49x - 63

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

Please help x – 6 ≥ –7?

Answers

Answer:

x ≥ -1

Step-by-step explanation:

just add 6 to both sides.

Answer:

Inequality Form: x≥−1

Step-by-step explanation:

A rectangular field is 0.35 kilometers long and 0.2 kilometers wide. What is the area of the field in square meters?
I need step-by step work?

Answers

Answer : 70 square meter

Area of rectangle = length x width

Here, Area of rectangle = 0.35 x 0.2 = 0.07 square km which is 70 square meter

As answer is required in square meter, you need to convert kilometer into meter.

The area of the rectangular field is 70000 square m if the rectangular field is 0.35 kilometers long and 0.2 kilometers wide.

What is the area of the rectangle?

It is defined as the area occupied by the rectangle in two-dimensional planner geometry.

The area of a rectangle can be calculated using the following formula:

Rectangle area = length x width

Area of rectangle = 0.35x0.2 = 0.07 square km

1 km = 1000 m

1 square km = 1000000 square m

Area of rectangle = 0.07x1000000 square m

Area of rectangle = 70000 square m

Thus, the area of the rectangular field is 70000 square m if the rectangular field is 0.35 kilometers long and 0.2 kilometers wide.

Learn more about the rectangle here:

https://brainly.com/question/15019502

#SPJ2

To wrap a gift, you can choose from 6 kinds of wrapping paper, 3 gift bags, 4 colors of ribbon, 2 bows, and 5 stickers. You choose either a style of wrapping paper or a gift bag. Then you choose one of each of the remaining items. Find the total number of ways you can wrap the gift.

Answers

Answer:

the answer would be 480 different ways because you would multiply all the numbers.

PLEASE HELP GEOMETRY!!!!!!!! DUE TODAY

What is the measure of

Answers

(D) step by step below

NEED HELP ON THIS ASAP PLZ!!​

Answers

Answer:

cos0 = 6.8556546i/23 or sqrt-47/23

Step-by-step explanation:

hypotenuse is 23, opposite is 24

we have to find the adjacent using the pythagorean theorem

24^2 + b^2 = 23^2

576+b^2=529

subtract

b^2=-47

b=sqrt-47

sqrt of -47 is 6.8556546i, there is an i since it is the square root of a negative

cos = adjacent/hypotenuse

Nori had 2 bags of apples. He used 1. bags of apples to make pies. How
many bags of apples does Nori have left?

Answers

Answer:

8/12 left

Step-by-step explanation:

8/12 of a bag left

2 1/12 = 25/12

1 5/12 = 17/12

25-17 = 8

The answer is 8/12

Answer:

1

Step-by-step explanation:

2 there are 2 and 1 Number before 2 is 1 so it one

What is the product?
(-282 +8)(502-65)

Answers

Answer:

option c is the answer for pic

and for question the answer is

(-274)*(437)

-119738

Answer:

the first one

Step-by-step explanation:

will give brainly please help now <3

Answers

Answer:

16 ounces/minute

Step-by-step explanation:

1 pound = 16 ounce

60 pound = 960 ounce

1 hour = 60 minute

960/60 = 16

A new car has a sticker price of $22,450, while the invoice price on it was $19,450. what is the dollar amount of markup​

Answers

Answer:

Step-by-step explanation:

Dollar amount of markup  = sticker price - invoice price

sticker price is what you pay to buy the car

invoice price is what the dealership has to pay the manufacturer of the car.

sticker price = 22450

invoice price = 19450

Dollar amount of the markup = 22450 - 19450

Dollar amount of the markup = 3000

4. If your balance on an investment of $100 that has been invested at
a rate of 7.5% is $178.35 at the end of 8 years, does the plan have simple
interest or compound interest?

Answers

Answer:

Simple interest

Step-by-step explanation:

Because its a period of 8 years

A survey of 100 people in high school was used to find what subject was preferred. Fill in whats missing

What's the joint frequency a 9th grader liked math?
Whats the marginal relative frequency of 9th graders surveyed
Given a student was in 10th grade, whats the likelyhood the student preferred english?
Given the subject was science, whats the likelyhood the student was a freshman?
Please help i really dont know what to do

Answers

Question: What's the joint frequency a 9th grader liked math?

Answer: 3%

Explanation:

Check out the attached image below. I've filled in the table with the missing values. The upper left corner is 3 because 7+3 = 10 in the first column. You'll fill in the other values in a similar fashion. Once we filled out the table, we can answer all of these questions. There are 3 ninth graders who like math out of 100 people total. So the final answer is 3/100 = 0.03 = 3%.

-----------------------------------

Question: What's the marginal relative frequency of 9th graders surveyed?

Answer: 10%

Explanation:

Again, refer to the table to find that there are 10 ninth graders out of 100 total. So 10/100 = 0.10 = 10% is the answer.

-----------------------------------

Question: Given a student was in 10th grade, what's the likelihood the student preferred English?

Answer:  46%

Explanation:

We only focus on the 10th graders because of the "given". There are 23 people in this row who like English out of 50 total sophomores. So 23/50 = 0.46 = 46% of the tenth graders liked English.

-----------------------------------

Question: Given the subject was science, what's the likelihood the student was a freshman?

Answer: 72.5%

Explanation:

Focus on the science column only. There are 29 freshmen out of 40 students total. We get the percentage of 29/40 = 0.725 = 72.5%

Other Questions
Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!! A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable. A corporation declares a cash dividend on Friday, December 5th, payable to holders of record on Friday, December 19th. The local newspaper publishes the announcement on Monday, December 8th, while Standard and Poor's reports the dividend on Friday, December 12th. The ex date for regular way trades will be set at: A Friday, December 5th B Wednesday, December 17th C Thursday, December 18th D Friday, December 19th our situation is ____ to the problems the warehouse staff dealt with last year. analogous, opposite, incongruous, conducive, symmetrical Please help, show work! Limits and functions! 85 points! Answer for fee rbux and branlest!!!! i need answer NOW or i will be DIE (not good!!!) 61 1/20 as a decimal The length of a rectangle is six times its width.If the perimeter of the rectangle is 84 in, find its area.