Kingston Falls is a town in Pennsylvania as well as the location of the events that occurred in “Gremlins”.
Who was Gremlins?The events in the movie "Gremlins" took place in the Pennsylvania village of Kingston Falls. A postcard-perfect scene can be seen in the fictional Pennsylvanian tiny hamlet of Kingston Falls.
The town has a large population, and one of its most renowned residents, the wealthy and ruthless widow Ruby Deagle, effectively runs everything. After the movie theater explosion and other devastation the gremlins inflicted, the town was in desperate need of restoration.
A significant gremlin outbreak that caused significant damage and a few fatalities was one prominent occurrence. Fortunately, the beasts were destroyed, making the village once again secure.
Therefore, Kingston Falls is a town in Pennsylvania as well as the location of the events that occurred in “Gremlins”.
To learn more about Gremlins, refer to the link:
https://brainly.com/question/13278830
#SPJ4
Zeke is attempting to learn more about his world. when he encounters a new object, he picks it up and puts it in his mouth. zeke is most likely in which of jean piaget’s stages of cognitive development?
Zeke is trying to learn more about the world around him. He takes a new object and puts it in his mouth whenever he sees it. Zeke is most likely in the sensorimotor stage of jean Piaget's stages of cognitive development.
Sensorimotor stage: Children use their natural abilities of looking, sucking, grasping, and listening during this early stage of development to gain a deeper understanding of the world around them. To put it another way, they learn about the world through their senses and movements. Children gain a deeper understanding of the world around them through trial and error.
Because infants acquire a fundamental understanding of the world around them through their senses and motor skills, Piaget chose to refer to this stage as the "sensorimotor stage." Infants are able to interact and develop an awareness of themselves and their surroundings thanks to the combination of physical abilities that continue to develop like Zeke picking up the objects and putting them in his mouth is his attempt to learn more about his world.
Know more about the Sensorimotor stage here: https://brainly.com/question/14780906
#SPJ4
(complete question)
Zeke is attempting to learn more about his world. When he encounters a new object, he picks it up and puts it in his mouth. Zeke is most likely in which of Jean Piaget’s stages of cognitive development?
answer choices
Sensorimotor
Preoperational
Concrete operational
Formal operational
Postconventional
A couple has adopted three children from Korea and reared them in a loving home--two of the children are MZ twins and the third is unrelated to the first two. As adults, researchers find that a correlation of .6 on various personality characteristics between the MZ twins. Which of the following correlations would the researchers expect to find between the MZ twins and their adopted sister?
Select one:
a. .6
b. -.3
c. .3
d. .0
Answer:
d,becouse the researchers do not expect to find any thing.
How is a plaque similar to a bacterial colony?
Plaque similar to bacterial colony 1 virus replicates in a host and expands outwards to infect more and more cells germs multiply, spreading outward no bacterial lawn after one week of incubation; only dead cells No, a temperate phage.
Bacteriophage tail fibres attach to the proteins in cell walls. The host cell is infused with viral DNA. No coating is necessary. Lysogeny, cytoplasmic biosynthesis. lysing of the host cell. 2) Wildlife Plasma membrane proteins and glycoproteins serve as attachment sites. Capsid entry is mediated by receptor fusion or endocytosis. Enzymatic elimination of capsid proteins during uncoating. Biosynthesis in the cytoplasm or nucleus (DNA viruses) Cancer, sluggish viral infections, and latency. Nonenveloped viruses burst plasma membrane after being released through an enveloped virus' bud out.
To know more about Plaque
https://brainly.com/question/9411605
#SPJ4
Luis is studying agriscience in class and needs to list three challenges facing the agricultural industry today. Which of the
following would best complete his list? (5 points)
Challenges
• Water quality issues
• Climate change
O More farmers' markets opening
O Improvements in renewable energy
O Less available land to cultivate
O Decreasing world population
The world's expanding population, problems with water quality, and soil deterioration are some of the challenges that the agricultural industry is currently facing.
What is agriculture?Agriculture is defined as the study or practice of farming, which includes preparing the land for plant growth as well as raising animals for their meat, wool, and other goods.
Climate change and soil degradation difficulties, which reduce the appropriateness of the land for crop cultivation, are the most frequent issues that agricultural industries encounter.
Thus, the world's expanding population, problems with water quality, and soil deterioration are some of the challenges that the agricultural industry is currently facing.
To learn more about agriculture, refer to the link below:
https://brainly.com/question/3632132
#SPJ1
C. Less available land to cultivate.
I hope this helped! :)
The adequate stimulus for your auditory sense is
The following provides a sufficient audio stimulus: Vibration in a carrying medium serves as an appropriate stimulus for audition. We can hear underwater and via our skulls in addition to the usual conducting medium of air.
The correct physical domain of the sensory system under study is where the stimuli come from, therefore sounds are adequate stimulus for the auditory system and smells are adequate for the olfactory bulb. Light and light contrasts provide the visual system with the necessary stimulus. Audition. The following provides a sufficient audio stimulus: Vibration in a carrying medium serves as an appropriate stimulus for audition. We can hear underwater and via our skulls in addition to the usual conducting medium of air.The basic sensory receptor cells in the inner ear, known as hair cells, transduce, or change into electrical impulses that are sent to the brain, mechanical sensations generated by sound and head motions. The type and amount of energy needed to excite a particular sensory organ is the appropriate stimulus. Numerous sensory stimuli are divided into groups based on how they work and what they're used for.
Learn more about skull
https://brainly.com/question/28190325
#SPJ4
What type of asexual reproduction is snail?
However, some hermaphrodite snails reproduce asexually. In other words, the snail fertilises its own egg with its own sperm.
Some hermaphrodite snails can reproduce on their own without the help of another snail (this is called asexual reproduction). Even though some snails are hermaphrodites, they still require a partner to procreate (this is called sexual reproduction). Nerite snails do not reproduce asexually, unlike the majority of aquatic snails. Similar to fish, a female nerite snail will lay eggs that the male will fertilise. The developing larvae will then be dispersed throughout the tank with the eggs.
To learn more about snails click here:
https://brainly.com/question/2961767
#SPJ4
What solute is found in plasma?
Plasma contains more than 90% water. The remainder is primarily made up of dissolved solutes like glucose, lipids, electrolytes, and dissolved gases, as well as plasma proteins, primarily albumin, globulins, and fibrinogen.
What are the three dissolved substances in plasma?Essential components including water, salt, and enzymes are also present in plasma. These also include antibodies and coagulation components like albumin and fibrinogen.
Does plasma contain any dissolved solutes?Plasma proteins, electrolytes (including sodium, potassium, and calcium), dissolved gases (like oxygen and carbon dioxide), and organic nutrients are among the dissolved solutes that can be found in plasma (such as glucose, amino acids, lipids).
To know more about Plasma visit:-
https://brainly.com/question/18207038
#SPJ4
Where is the organized form of DNA?
Chromosome is the final organized form of DNA which is present within the nucleus.
Cells enclose their DNA strands all over scaffolding proteins to construct chromatin, a coiled compressed structure inside the nucleus. Chromatin is hence rolled up into higher powers of structure, resulting in the distinctive shape of chromosomes.
The DNA molecule is encapsulated into thread-like structures known as chromosomes in the nucleus of each cell. Each chromosome is composed of DNA that has been tightly coiled many times around proteins known as histones that support its structure. Chromatin coils tightly and compresses to create chromosomes when a cell is poised to divide.
For more information on Chromosomes, visit :
https://brainly.com/question/12537598
#SPJ4
Protozoa are known for their cell walls.True or False? Amoeba can be parasitic. True or false Bacteria have cell walls: true or falseA cell has the following molecules and structures: enzymes, DNA, ribosomes, plasma membrane, and mitochondria. It could be a cell from which of the following? A)a bacterium B)a plant, but not an animal C)either a plant or an animal D)an animal but not a plant E) any kind of organismAmoeba are: a) anaerobic organisms b) aerobic organismsA cellular diameter of 40 micrometers is equivalent to: (a)0.4mm (b)0.04mm (c)40nm (d).4cmHow does the composition of bacterial cell walls differ from that of plant cell walls? a)Bacteria have an extensive network of crosslinked teichoic acids in their cell walls, while plant cell walls are composed primarily of cellulose b)Bacteria have cell walls composed of peptidoglycan, while plant cell walls are composed primarily of cellulose. c)Both plants and bacteria have cell walls composed of cellulose; the cellulose fibers are more extensively crosslinked in bacteria than in plant cells. d)Bacteria have cell walls composed of chitin, while plant cell walls are composed primarily of cellulose.Chloroplasts enables the Euglena to be photoautotrophic? true or falseA Trypanosome is a(n): a) Ciliate b) euglenozoan c) Brown algae d)loboseAmoebozoan aramecium are prey for: a)other protists. b)bacteria. c)other species of Paramcium d)land animals.Which of the following protozoa are parasites?a)Euglena b)Paramecium caudatum c)Trypanosoma cruzi d) Amoeba proteus e)Giardia intestinalis f) Plasmodium falciparum
The following are the answer to the given microorganisms related questions:
Cell walls of protozoa are well-known for this. (False)
Parasitic amoeba are possible. (True)
Cell walls exist in bacteria. (True)
Enzymes, DNA, ribosomes, plasma membrane, and mitochondria are just a few of the chemicals and structures found in a cell. It might be: (C) either an animal or a plant.
An amoeba is: aerobic organisms (b)
40 micrometre cellular diameter is equivalent to: (b) 0.04mm
The Euglena is able to be photoautotrophic thanks to chloroplasts. (True)
A (n) trypanosome is: b) Prey species for euglenozoan Amoebozoan aramecium include: b) Parasites are bacteria and protozoa: Trypanosoma cruzi and Plasmodium falciparum are parasites.
Bacterial cell walls different from plant cell walls in composition
Ans- (b) Cell walls of bacteria are made of peptidoglycan, whereas cellulose predominates in plant cell walls.
To learn more about microorganisms, refer: https://brainly.com/question/9148161
#SPJ4
Theres no science option so I put it in this category.
Drag the item from the item bank to its corresponding match.
change of velocity per time is acceleration
measure of quantity of matter is mass
measured value is distance
time is the first one
resistance to effort force is velocity
describe what is the difference of protein coagulation mechanism (specifically casein) between yogurt and cheese making? (think about what caused casein to coagulate during these two procedure, and describe in detail)
Yogurt
Produced by milk fermentationLactic acid provides the tangy flavor in Yogurt Bacteria will ferment sugars in milk to produce lactic acid. therefore mixture become acidicHigher acidity solidifies the casein proteinsCheese
Produced by acidification of milkbacteria provide the taste in cheese.coagulation of casein protein in milk separatingthe milk into solid curds and liquid whey. liquid whey is drained away, and the curds are salted, shaped and left to ripen in a controlled environment.Casein molecules have hydrophobic and hydrophilic regions in the molecules.This leads to formation of micelles.Micelles are globular round structures which float around in milk.Coagulation is done by
Lower the pH ( by the addition of an acid or by the addition of micro organisms that make acids) Addition of enzymeThese two causes the stable micelles to lose stability and curdle into larger aggregates.The lower pH will destabilize the casein micelles and cause them to aggregate.They will form clumps which catch the fat and which will form the final cheeseEnzymes change the size of the proteins.Learn more about Yogurt to visit this link
https://brainly.com/question/7580803
#SPJ4
16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe
The phenotype is affected by mutations 1 and 2 because in the first, the complete protein is altered, and in the second, the new amino acid may cause the protein to have altered or no function.
What is Mutation?
Mutations can happen naturally or as a result of UV rays, congenital conditions, ionic radiations, or specific free radicals.
Even with the point mutation, there is no alteration to the amino acid sequence, hence the protein will not be affected.
In mutation 1, a new nucleotide is added at codon 9, changing the whole sequence of amino acids and codons in the process, mutation frameshift.
Because a new codon was created as a result of the substitution of one nucleotide by another in mutation 2, produced a new amino acid, so Point mutation.
Therefore, in mutation 3, one nucleotide is swapped out for another, and the resulting codon codes the same amino acid as the one before it, so point mutation.
Learn more about mutation, here:
https://brainly.com/question/17130462
#SPJ4
Why adenine and thymine have 2 hydrogen bonds while guanine and cytosine have 3 hydrogen bonds?
These pairings take place because of the geometry of the bases, which only permits hydrogen bonds to form between certain pairs. While cytosine and guanine will make three hydrogen bonds, adenine and thymine will only form two.
As a result of the alignment of adenine and thymine, a hydrogen bond can develop between the exocyclic amino group at C6 on adenine and the carbonyl at C4 in thymine, as well as between N1 of adenine and N3 of thymine. Hence a total of two hydrogen bonds are possible .Because the exocyclic NH2 at C2 on guanine stands opposite to and can form a hydrogen bond with a carbonyl at C2 on cytosine, the base pair of guanine and cytosine possesses three hydrogen bonds.
Learn more about Hydrogen bond here:
https://brainly.com/question/28026490
#SPJ4
Learn more about Hydrogen bonds here:
the most common type of regenerated fiber, which is derived from cellulose and is mostly plant in origin, is rayon.T/F
Correct answer is :- TRUE
It is true that rayon, which is derived from cellulose and has a largely plant-based origin, is the most popular type of regenerated fiber. this is due to the cellulose-based fibers used in the plastic polymer strings, all of which start with oil products. Polyester resembles fiber in some ways, however it is easily destroyed by sunlight and strong acids.
know more about cellulose here
https://brainly.com/question/27963779#
#SPJ4
extracellular endolymph surrounding the organ of corti contains fluid: a) high in potassium and low in sodium b) high in potassium and sodium c) low in potassium and high in sodium d) low in potassium and sodium
The high in potassium and low in sodium is theextracellular endolymph surrounding the organ of corti contains fluid.
Endolymph, additionally called Scarpa fluid, is a clean fluid which could discovered withinside the membranous labyrinth of the internal ear. It is particular in composition as compared to different extracellular fluids withinside the frame because of its excessive potassium ion concentration (one hundred forty mEq/L) and coffee sodium ion concentration (15 mEq/L).
Note that simplest the floor of the organ of Corti is bathed in endolymph (significantly the stereocilia of the hair cells), at the same time as the primary frame of hair cells and guide cells are bathed in perilymph. There are varieties of perilymph: the perilymph of the scala vestibuli, and that of the scala tympani.
Read more about potassium;
https://brainly.com/question/17625758
#SPJ4
How is protein made using the information from amino acid?
A complex collection of molecules known as ribosome it is used by cells to assemble proteins. The ribosome puts amino acids in the correct order and connects them with peptide bonds. A polypeptide chain—a lengthy collection of amino acids—is produced by this procedure, known as translation.
Which proteins are produced using amino acids?Amino acids unite to form peptide bonds, which are another name for proteins known as polypeptides. Depending on the interactions (dashed lines) between the side chains of the polypeptide's amino acids, the polypeptide will then fold into a particular shape.
Are amino acids present in all proteins?All proteins are made up of one or more chains of amino acids, despite the fact that their shapes, as well as their functions, vary widely.
To know more about protein visit:-
https://brainly.com/question/29776206
#SPJ4
The haploid number of chromosomes of a plant is 20. the number of chromosomes in root, stem, and leaf cells would be?
The number of chromosomes in root, stem, and leaf cells would be 40.
Chromosomes are thread-like structures made of protein and a single DNA molecule that transport genomic information from cell to cell. Chromosomes are found in the nucleus of cells in plants and animals.
A chromosome is a long DNA molecule that contains all or part of an organism's genetic material. Most chromosomes have very long thin DNA fibers coated with packaging proteins; the most important of these proteins in eukaryotic cells are the histones.
Genetic diversity is greatly influenced by chromosomal recombination during meiosis and subsequent sexual reproduction. If these structures are incorrectly manipulated, as with chromosomal instability and translocation, the cell may undergo mitotic catastrophe.
Normally, this causes the cell to initiate apoptosis, which leads to its own death, but mutations in the cell can impede this process and thus cause cancer progression.
To learn more about number of chromosomes, here
https://brainly.com/question/27419643
#SPJ4
Explain the process of wastes and nutrients leaving the cell
What is cancer and how does it relate to the cell cycle and mitosis?
Cancer is related to the cell cycle and mitosis because by drilling down to the atomic level of how specific proteins interact during mitosis, a a unique new target for attacking cancer is found.
Mitosis is a type of cell division in which one cell( the mama ) divides to produce two new cells( the daughters) that are genetically identical to itself. In the environment of the cell cycle, mitosis is the part of the division process in which the DNA of the cell's nexus is resolve into two equal sets of chromosomes.
Cancer is a term for conditions in which abnormal cells divide without control and can incursion near apkins. Cancer cells can also spread to other corridor of the body through the blood and lymph systems. There are several main types of cancer.
To learn more about mitosis here
brainly.com/question/29776367
#SPJ4
Select the statements that accurately characterize T-cell activation.
a. CD8+ cells are stimulated by antigen bound to MHC I molecules.
b. T helper cells play a role in B-cell activation.
c. CD4+ cells are stimulated by antigen bound to MHC II molecules.
d. TH17 cells lead to the development of inflammatory reactions.
e. Activation of CD4+ T cells leads to the development of TC cells only.
that precisely describe the activation of T cells. Antigen that has been attached to MHC I receptors stimulates CD8+ lymphocytes. In the stimulation of B-cells, T helper cells are involved. The formation of inflammatory responses is facilitated by Il-17.
When tissues are harmed by infection, trauma, toxins, heat, or really any cause, the inflammatory response (also known as inflammation) takes place. Chemicals like histamine, cholecystokinin, and prostaglandins are released by injured cells. These substances promote inflammation by spurting blood capillaries to bleed water into the tissues. organisms pathogens such as bacteria, such as bacteria, viruses, or fungi. Explicit wounds such as scratches or injury with foreign items effects of radiation or chemicals
Learn more about inflammatory her:
https://brainly.com/question/29774118
#SPJ4
Vitamin e's primary function is as _______ that neutralizes potentially harmful free radicals in the body.
Vitamin E's primary function is as an antioxidant that neutralizes potentially harmful free radicals in the body.
Vitamin E is made up of eight fat-soluble compounds, four of which are tocopherols and four of which are tocotrienols. Vitamin E deficiency, which is uncommon and usually caused by an underlying problem with dietary fat digestion rather than a low vitamin E diet, can cause nerve problems.
Nausea, fatigue, headache, and bleeding are all possible side effects. When taken in doses greater than 1000 mg per day, vitamin E may be hazardous. When applied to the skin, vitamin E is most likely safe for the majority of people. Vitamin E is an essential nutrient for vision, reproduction, and the health of your blood, brain, and skin. Vitamin E has antioxidant properties as well. Sunflower seeds, almonds, spinach, avocados, squash, kiwifruit, trout, shrimp, olive oil, wheat germ oil, and broccoli are all high in vitamin E.
To learn more about Vitamin E, here
https://brainly.com/question/10670287
#SPJ4
how did mendels experiments with peas convince him that there were disfuct units of heritance that were not blended together in the offspring
Mendel conducted this well-known experiment in which he purposely cross-pollinated pea plants based on their many characteristics in order to learn crucial truths about how traits are passed down through the generations.
What is Mendel's experiment?Because he noticed that specific features were regularly and predictably passed from one generation to the next, Gregor Mendel was convinced by his studies with peas that there were discrete units of heredity, today is known as genes.
For instance, he discovered that the progeny of crosses between purebred pea plants with tall stems and those with short stems all produced long stems. But when he let these kids self-pollinate, around three-fourths of the offspring had tall stems, while roughly one-fourth had short stems.
Therefore, Mendel's research served as the cornerstone for the modern understanding of genetics and the function of genes in inherited traits.
To learn more about Mendel's experiment, refer to the link:
https://brainly.com/question/29775819
#SPJ2
What is the name of the process where adaptations that are beneficial for survival in a particular environment get passed on to offspring?
The name of the process where adaptations that are beneficial for survival in a particular environment get passed on to offspring is called Natural selection.
Natural selection is the mechanism through which living creature populations adapt and change People in a population are naturally diverse, which means they vary in certain ways.
This variation shows that some persons are more environment-adapted than others in terms of their personal traits. Individuals that possess adaptive features (traits that provide them an advantage) are more likely to live and reproduce.
Individuals then pass on their adaptive characteristics to their children. These beneficial features grow increasingly widespread in the population over time. Natural selection ensures that beneficial traits are handed down across generations.
Natural selection can result in speciation, which occurs when one species gives rise to a new and separate species. It is one of the mechanisms that drives evolution and contributes to our understanding of the variety of life on Earth.
learn more about Natural Selection at https://brainly.com/question/23929271
#SPJ4
which statement is true regarding the activation of pyruvate carboxylase by acetyl coa? a)feedback activation enhances flux through glycolysis. b)feedforward activation enhances the entry of pyruvate through the tca cycle as acetyl-coa. c)ensures that gluconeogenesis occurs rather than pyruvate conversion to acetyl-coa. d)ensures that atp is not wasted in the production of oxaloacetate. e)feedback inhibition
The statement that ensures that gluconeogenesis occurs rather than pyruvate conversion to acetyl-CoA is true regarding the activation of pyruvate carboxylase by acetyl CoA (Option C).
What is the process of gluconeogenesis?The process of gluconeogenesis refers to a metabolic signaling pathway capable of generating glucose from non-carbohydrate compounds, which is in this case produced by the activation of pyruvate carboxylase via acetyl CoA.
Therefore, with this data, we can see that the process of gluconeogenesis can be achieved by activating the enzyme pyruvate carboxylase by acetyl CoA which participates in many reactions.
Learn more about the process of gluconeogenesis here:
https://brainly.com/question/1425339
#SPJ1
What is the most common theme of haiku?
Feelings about Nature are the most common theme of haiku.
A haiku is a type of poetry from Japan that dates back to the ninth century. There are three lines in a haiku. The standard metric for haiku is 5-7-5, but modern haiku rarely adhere to that format.
The primary purpose of haiku poems is to convey feelings about nature. Time, nature, emotions, and other topics were addressed in traditional poems. They are intended to be instructive for the readers. The Western Haiku, on the other hand, deals with anything that could be a subject. Poems cover a wide range of topics, including houses, drainages, dogs, and cats. However, serious poets make a concerted effort to adhere strictly to the Japanese Haiku format.
know more about Japanese Haiku here: https://brainly.com/question/29553627
#SPJ4
Information for specifying the traits of an organism is carried in the DNA. Your teacher asked you to explain to the class how DNA code
produces genetic traits in organisms. What is the best explanation?
Answer:
DNA carries all of the information for your physical characteristics, which are essentially determined by proteins. So, DNA contains the instructions for making a protein. In DNA, each protein is encoded by a gene (a specific sequence of DNA nucleotides that specify how a single protein is to be made).
Explanation:
a condition when the coronary arteries are blocked thus preventing oxygenated blood from circulating within the heart is called:
A condition when the coronary arteries are blocked thus preventing oxygenated blood from circulating within the heart is called chronic total occlusion (CTO).
A chronic total occlusion (CTO) is a blockage in your coronary corridors, the veins that supply blood to your heart. Plaque, a fatty substance that builds up and narrows your arteries, typically causes blockage. If you have coronary artery disease, your risk of developing a CTO is higher.
Coronary artery disease (CAD) patients are more likely to experience chronic total occlusions. One in three people who suffer from CAD also has a CTO. A common heart condition is coronary artery disease. Coronary arteries, the major blood vessels that supply the heart, struggle to deliver sufficient blood, oxygen, and nutrients to the heart muscle.
Know more about Coronary artery disease here: https://brainly.com/question/1347334
#SPJ4
What are complex traits affected by?
Answer:
From variation within multiple genes and their interaction with behavioral and environmental factors.
How do you calculate population time?
To figure out how long it would take a population to double at a single rate of growth, we can use a simple formula known as the Rule of 70. Basically, you can find the doubling time (in years) by dividing 70 by the annual growth rate.
How do you calculate population over time?Population Growth Calculation To calculate the Population Growth (PG) we find the difference (subtract) between the initial population and the population at Time 1, then divide by the initial population and multiply by 100. The Population Growth Rate (PGR) for that period of time (10 years) was 12%.
How to calculate population?The best way to measure the size of a population is to count all the individuals in that population. When determining the population sizes of trees or other relatively immobile organisms, this method is practical. If the organism is mobile, however, such as a fish, counting every individual would be difficult.
To know more about calculate population time visit :-
https://brainly.com/question/29128892
#SPJ4
What is the specific purpose of meiosis 1?
The specific purpose of meiosis 1 is to reduce the chromosome number by half in order to produce haploid reproductive cells from a diploid cell.
What is a Diploid cell?
A diploid cell is a cell that contains two sets of chromosomes, one set inherited from each parent. Diploid cells are the basic structural unit of life for all living organisms. These cells are responsible for growth, repair, and reproduction.
What is meiosis 1?
Meiosis 1 is the first part of meiosis, a type of cell division that produces gametes (sex cells) for sexual reproduction. Meiosis 1 consists of two successive divisions of the cell's nucleus, resulting in four daughter cells with half the number of chromosomes as the original cell. During meiosis 1, homologous chromosomes pair up and exchange genetic material, a process known as crossing over. The resulting cells are haploid, meaning they contain only one copy of each chromosome.
This process involves the separation of homologous chromosomes, which are pairs of chromosomes that contain the same genes.
To know more about Meiosis 1,
https://brainly.com/question/8253366
#SPJ4