What’s the answer to this?

Whats The Answer To This?

Answers

Answer 1

Answer:

I would say the answer is c p=6n+18 because im thinking you are dealing with input-output

Step-by-step explanation:


Related Questions


9. The diagram shows a triangle inscribed in a circle with centre O.
The lengths of the shorter sides of the triangle are 6 cm and 8 cm.
Work out the area of the circle.
Use π = 3.14.​

Answers

Answer:

25π

Step-by-step explanation:

let c = length of third side of triangle

since you are working with a right triangle you can find the third side by using the pythagorean theorem:  8^2 + 6^2 = c^2

64 + 36 = c^2

100 = c^2

c = 10

10 is also the diameter of the circle and radius is 5

A = π · r²

A = 5^2÷ (3 ^4 · x^24 · y^12)

A = 25π

plz help............ ​

Answers

4. x.y

Step-by-step explanation:

thats the answer, Its number 4

The answers are 7, 15, 5, and 10

Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong.

Answers

Answer:

360

Step-by-step explanation:

hope this helps.

Use the right triangle shown to answer the question.
26
32°
*not drawn to scale
What is the approximate value of x?

Answers

Answer:45

Step-by-step explanation:

Answer:13.8

Also Stop cheating

What is the largest 2-digit composite number divisible by 46? ​

Answers

Answer:

92

Step-by-step explanation:

its 92 because its is a 2-digit number and is considered composite because its divisible by 2, 4, 23 and 46

The largest 2-digit composite number divisible by 46 is 92 and this can be determined by using the definition of composite numbers and by arithmetic operations.

Given :

Number - 46

The following steps can be used to determine the largest 2-digit composite number divisible by 46:

Step 1 - Remember that composite numbers are those numbers that are divisible by more than two numbers.

Step 2 - The two-digit composite numbers which are divisible by 46 are 46 and 92.

Step 3 - The largest number between 46 and 92 is 92.

So, the largest 2-digit composite number divisible by 46 is 92.

For more information, refer to the link given below:

https://brainly.com/question/1669816

−3x−9y=−12
−3x+7y=4
solve for x

Answers

Answer:

[tex] \huge{ \boxed{ \boxed{ \sf{ \red{ \sf{x = 1}}}}}}[/tex]

Step - by - step explanation :

[tex] \underline{ \underline{ \sf{Solution}}} : [/tex]

USING ELIMINATION METHOD :

[tex] \sf{ - 3x - 9y = - 12}[/tex] ••••••• equation ( i )

[tex] \sf{ - 3x + 7y = 4}[/tex] ••••••• equation ( ii )

Subtracting equation ( ii ) from ( i )

Note that while subtracting equation ( ii ) from ( i ) , sign of each term of equation ( ii ) changes and hence becomes 3x - 7y = -4.

[tex] \sf{ \cancel{ - 3x} - 9y = - 12}[/tex]

[tex] \sf{ \cancel{3x} - 7y = - 4}[/tex]

_____________________

➺ [tex] \sf{ - 16y = - 16}[/tex]

➺ [tex] \sf{ \frac{ - 16y}{ - 16} = \frac{ - 16}{ - 16}} [/tex]

➺ [tex] \sf{y = 1}[/tex]

The value of y is 1. Since , we are asked to find the value of x , substituting the value of y in equation ( i) , we get :

➺ [tex] \sf{ - 3x - 9 \times 1 = - 12}[/tex]

➺ [tex] \sf{ - 3x - 9 = - 12}[/tex]

➺ [tex] \sf{ - 3x = - 12 + 9}[/tex]

➺ [tex] \sf{ - 3x = - 3}[/tex]

➺ [tex] \sf{ \frac{ - 3x}{ - 3} = \frac{ - 3}{ - 3}} [/tex]

➺ [tex] \sf{ x = \boxed{ \bold{ \red{ \sf{1}}}}}[/tex]

Hence , the value of x is 1 .

⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆

☞ [tex] \underline{ \sf{Extra \: Info}} : [/tex]

There are many methods to solve such simultaneous equations. They are :

Graphical method : In this method , we find a few pairs of solutions to each of two given equations. The pairs of solutions of each equation are plotted in a graph and by joining them, two separate straight line lines are obtained. The coordinates of the point of intersection of two straight lines are the solutions to the given equation.

Elimination method : In this method, we add or subtract the given equations to eliminate one of the two variable by making their coefficients equal. Then , a single equation with one variable so obtained is solved to find the value of the variable. The value of the variable is substituted to any one equation to find the value of the eliminated variable.

Substitution method : In this method , a variable is expressed in terms of another variable from one equation and it is substituted in the remaining equations.

⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆

✑ Learn more :

Solve system of equations using elimination method :

https://brainly.com/question/20160304

What is the substitution method ?

https://brainly.com/question/15936865

Hope I helped ! ツ

Have a wonderful day / night ♡

▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁

Brainliest brainliest brainliest

Answers

first is 27
second one is 9

Answer:

27 and 9

Step-by-step explanation:

27 divided by 1 = 27

27 divided by 3 = 9

:)

HELP Darius owns a business that manufactures and sells record players, now that vinyl records have resurged in popularity. The graph shows Darius's expected revenue and cost in relation to the price he sets for each record player.​

Answers

Answer: 32 and 85

Step-by-step explanation:

Darius set the price between $32 and $85.

What is Graph?

The graph is simply a structured representation of the data. It aids in our comprehension of the data. The numerical information gathered through observation is referred to as data.

Given:

We have the graph shows Darius's expected revenue and cost in relation to the price he sets for each record player.​

For the expected revenue = 32 the cost is $5539.

and, For the expected revenue = 85 the cost is $4062.

and there is a peak at expected revenue 52.

Then, for profit Darius set the price between $32 and $85.

Learn more  about Graph here:

https://brainly.com/question/17267403

#SPJ5

Helppppp pleaseeeeee

Answers

Answer:

it is c

Step-by-step explanation:

use your brain

Answer:

C

Step-by-step explanation:

the lowest y coordinate is -1 with a closed point which means its included while the highest point is 4 with an open circle which means 4 is not included

What is the mean of the data set?

82, 105, 247, 119, 94, 202

Answers

i got the totally of 141.5

just add them all up to get 849

and divide them by how many numbers there are

which is 6

6th grade math help me plzzzz

Answers

Answer:

E. would be your answer

Step-by-step explanation:

ok so find an angle on figure A. and count how many units it takes to get to the same angle on figure B.

Amanda and Ndiba are selling flower bulbs for a school fundraiser. Customers can buy packages of tulip bulbs and bags of daffodil bulbs. Amanda sold 6 packages of tulip bulbs and 12 bags of daffodil bulbs for a total of $198. Ndiba sold 7 packages of tulip bulbs and 6 bags of daffodil bulbs for a total of $127. Find the cost each of one package of tulips bulbs and one bag of daffodil bulbs.
Please answer with work, need this quick! thanks

Answers

Answer is on the attachment. Brainlist pls.

Step-by-step explanation:

Help me out with this please??? someone??? A model airplane is built with a wing span of 23 inches. The actual wingspan is 92 feet. What is the scale of the model???

Answers

Answer:

The scale is five. you do 90 divided by 18.

The sum of 3 times a number and
twice the same number
is less than 45.
a) 3n + 2n < 45
b) 3n + 2 > 45
c) 3(n + 2) < 45
d) 2(n + 3) < 45

Answers

Answer:

poop

Step-by-step explanation:

poop

The answer is C because the numbers are being multiplied by 3

to stay healthy we should drink 6 1/2 glasses of water a day. if we follow guidelines how much water would we drink in a full week

Answers

Answer:

Step-by-step explanation:

Saying that each glass is 8 ounces if you drink 6.5 glasses a day your drinking 52 ounces a day. Seven days are in a week 52 ounces times 7 days gives you 364 ounces a week 364 ounces divided by 8 ounces per glass gives you 45.5 glasses in a full week

Mr. O’Hara found that on a recent trip his car used 12 gallons of gas to drive 396 miles. Assume that m represents the number of miles driven and g represents the number of gallons of gas used. What value makes the equation m=_*g represent the relationship between gallons of gas and miles driven?

Answers

Answer:

I think the answer would be 33. I am not exactly sure though.

What’s the sum of -3a+2 and 5a-3

Answers

Answer:

2a-1

Step-by-step explanation:

Answer:

2a-1

Step-by-step explanation:

you take the -3a and add the 5a, and that gives you 2a. 2-3 is -1.

38. Which ordered pair is a solution to the
equation y = 2 - x?
a) (5,3)
b) (8,10)
c) (-1,1)
d) (-5,7)

Answers

Answer:

d

Step-by-step explanation:

y=2-x

because

7=2-(-5)

7=7

Write 264 as a product of primes. Use index notation when giving your answer.

Answers

Answer:

2^3 times 11 times 3

Step-by-step explanation:

264

/     /

2    132

       /  /

      2  66

          /  /

         2  33

             /  /       11 and 3

-5x+7y=-34
-5x+3y=-6

Answers

Answer:

        x = -3,  y = -7

Step-by-step explanation:

-5x + 7y = -34     ⇒  -5x = -34  - 7y

    -5x + 3y = -6

-34  - 7y + 3y = -6

-34 - 4y = -6          {add 34 to both sides}

  -4y = 28             {divide both sides by (-4)}

     y = - 7

-5x + 3y = -6

-5x + 3(-7) = -6

-5x - 21 = -6        {add 21 to both sides}

-5x = 15            {divide both sides by (-5)}

  x = -3

What is the length of AB? 4 units 5 units 6 units 7 units

Answers

Answer:

the answer is 6 units

Step-by-step explanation:

find point A and point B and then just count the units over from

A to B and you will get AB is 6 units

Answer c

Step-by-step explanation: bc its 6 units

the sum of three numbers is 133. the third number is 4 times the second. the second number is 5 more than the first. 25 points+ brainliest

Answers

Answer:

I believe the answer is 6 times more.

Step-by-step explanation:

And I know ur gonna scam I'm just willing to help

B. Identify the kind of algebraic expression and determine the degree, variables
and constant
Constant
Variables
Degree
Algebraic Expression
Type/kind
1. 7x + 4x3 - 17
2. 3abc2 + a2bc2-abc + 2
3. x + 2x2 - 6x3 + 9x4 +1
4. 3xyz2 + 12
5. 14
can u help me I'm from Philippines​

Answers

9514 1404 393

Answer:

  see the attachment

Step-by-step explanation:

There are no roots, fractional powers, or denominators containing variables, so each of these expressions is the sum of multiples of products of variables to integer powers. (One is a constant.) That makes each expression a polynomial. Some polynomials can be further classified by their degree.

The degree is the highest sum of powers of the variables in the terms. For example, the term a^2·b·c^2 has variables with powers 2, 1, and 2. The sum of those powers is 2+1+2 = 5, so this is a term of degree 5.

A constant is a term with no variables.

__

It is customary in algebra problems to use variables that are a single lower-case letter. Sometimes, a variable may be represented by a letter in uppercase, or in a special font or language (usually Greek). Sometimes, it may be a word or phrase. Here, we assume each variable is one letter, so xyz is the product of three variables.

Perhaps the table below answers the questions you are asking about these expressions.

7(n+4)= 21 what’s does n equal

Answers

Answer:

Step-by-step explanation:

here you go mate

step 1

7(n+4)= 21  equation/Question

step 2

7(n+4)= 21  simplify

7n+28=21

step 3

7n+28=21  subtract

7n=-7

step 4

[tex]\frac{7n}{7} =\frac{-7}{7}[/tex]Divide

answer

n=-1

Find the mean and median of 0.55, 2 and 50%

Answers

12/25 = 0.48
0.55 = 0.55
50% = 0.5

Mean = (0.48 + 0.55 + 0.5) / 3 = 0.51
Median = 0.5

Answers:
Mean = 0.51
Median = 0.5

anyone know this, its rlly hard​

Answers

Answer:

......................................................................................................

Step-by-step explanation:

Please help down below

Answers

Answer:

1 7/10 is the answer

Step-by-step explanation:

let me know if not

Answer:

1 and 7/10

Step-by-step explanation:

Start off with making the fractions have common denomators by making 1/2 into 5/10 and 4/5 into 8/10

3-1=2, but the fractions go into negative, eating into the 2 whole number.

5/10-8/10=-3/10, or 1 and 7/10 total.

I hope this helps and you have a great day :)

Can someone really help me please!

Answers

Answer:  

Step-by-step explanation:  You can order without knowing the areas because of the size

Answer:

From Left to Right:

Large, Medium, Small

Explanation:

Assuming all the numbers are the same (chances are that they are seeing as they use the same variable ((the Greek lowercase letter known as Psi - Ψ)), then we should determine the area based on formulas.For the leftmost shape, you have to use the length * width formula TWICE and then subtract the missing area value to find the remaining area (which is--even after subtracting, the greatest than out of all the other shapes).For the middle shape, the formula you use is length * width-- which is less than that of the leftmost shape, but more than the rightmost shape.For the rightmost shape, the formula you use is (length * width)/2--which is half of the middle shape and less than the largest shape.

How would 2X + Y = 13 be written in slope-intercept form?

Answers

Answer:

[tex]y=-2x+13[/tex]

Step-by-step explanation:

For reference, slope-intercept form is:

[tex]y=mx+b[/tex]

[tex](m=slope)[/tex]

[tex](b=y-intercept)[/tex]

For the equation [tex]2x+y=13[/tex] to be written in slope-intercept form, all we must do is subtract [tex]2x[/tex] from both sides of the equation:

[tex]2x+y=13[/tex]

[tex]y=-2x+13[/tex]

please help and show work if you can ​

Answers

Answer:

9) 127 °

10) 67°

11) 100°

12) 118°

Step-by-step explanation:

adjacent angles in parallelograms are supplementary (their sum is 180°)

opposite angles are congruent

Other Questions
Which is a like radical to 3 sqrt 54 and 3 sqrt 128 when the expression are simplified? Which rule applies to the translation of the RED trapezoid to the BLUE trapezoid?)(c.y) - (x* 2, y- 3)B)(x. y) - (x+ 4, y- 5)(x, y) - (x + 2, y - 5)D)(.Y) - (x- 2, y - 5) what color is the darkest.A. RedB. BlueC. purpleD. Black Read this excerpt from from Robinson Crusoe:Then I took my turn, and embraced him as my deliverer,and we rejoiced together. I told him I looked upon him as aman sent from Heaven to deliver me, and that the wholetransaction seemed to be a chain of wonders (243).Based on the wording in this excerpt, which of the following is Crusoe mostlikely describing?O A. A mutineerOB. A cannibalOC. The captainOD. Friday the measure of G is 82. What is the measure of its compliment? facts on wourld war 2 TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA HELP! SSUUUUUUUUPER EASY! REEEEEEEEEEEALLY QUICK! I'm just du. mb Below is an equilateral triangle. Find the value of x, then find the value of a side length. How do we use positive and negative signs to communicate the direction of a vector Fill in the question mark area of the dimensional analysis set up with the correct conversion 3.25 x 10-3 molecules H2O x 1 mole moles PLEASSSS HELPPPP How do you feel about the way you spend money on needs and wants? Is there anything you'd like to change about your spending habits when it comes to needs versus wants? A party rental company has chairs and tables for rent. The total cost to rent 4 chairs and 8 tables is 89 . The total cost to rent 2 chairs and 3 tables is 34 . What is the cost to rent each chair and each table? PLEASE HELP WILL GIVE 10pts AND BRAINLIEST FOR THE RIGHT ANWSER!!!Jackson just started kindergarten and his teacher has noticed that he if having trouble identifying objects with their correct names and seems to have reduced complexity of vocabulary and sentence structure types. Based on this, what does Jackson's teacher suspect that he might be dealing with? A) emotional delayB) physical delayC) cognitive delayD) speech delay In 35 words or fewer, why do you think it's important to learn about thepurpose, context, and audience of a rhetorical work like a speech? what type of speech would the sentence The Kid Was A Young Albert Einstein Find the values of the variables in the parallelogram. Change these times to the 24-hour clock.c)8:15 pmd)midnight Los estudiantes ______ las preguntas.contestancontestamoscontestiscontesta (pls) Find the slope of the line through (9, 4) and (0, 5).