Whats the answer will give brainliest and explain you reasoning.

Whats The Answer Will Give Brainliest And Explain You Reasoning.

Answers

Answer 1

Answer:

Texbook because it's states the most information and I'd you find a random website on the internet the informations probably gonna be wrong and a crime novel isn't gonna have anything in it lol. Then a sales pamphlet ain't gonna be nothing but sales

Mark me as brainliest pls


Related Questions

Why does it take longer for your body to break down complex carbohydrates than simple carbohydrates?

Answers

Explanation:

complex carb pack more nutrients are simple carbs that are high in fiber and digest more slowly this makes them more ceiling which means a good option to for weight control

The small intestine is where carbohydrates are chemically broken down, instead of the stomach. The disaccharides and pancreatic amylase complete the chemical cleavage of digestible carbs.

What are the complex carbohydrates in the body?

The building blocks of large polysaccharides are lengthy, complicated chains of sugar molecules.

Peas, beans, whole grains, and vegetables are examples of foods that are sources of complex carbohydrates. The body converts simple and complex carbohydrates into glucose (blood sugar), which is then used as fuel.

Longer-lasting blood glucose increase and longer-lasting energy elevation are produced by complex carbs.

Therefore, complex carbs are more efficient in giving the body energy, which is the main purpose of carbohydrates.

Learn more about complex carbohydrate here:

https://brainly.com/question/9384195

#SPJ2

Trilobites
Trilobites were crab-like animals
that lived in ancient seas.
Scientists have discovered many
trilobite fossils all over the world.
However, the fossils only appear
in rocks that are at least 250
million years old. In more recent
rocks, their fossils are absent.
1. What conclusion would you
draw about trilobites based on
their appearance and
disappearance in the fossil
record

Answers

Answer:

The trilobites probably disappeared because either: A) they evolved into something else, or B) they died out due to the amounts of land rising out of the ocean.

A paramecium's contractile vacuole pumps water out of the cell as a form of active transport.
1.True
2.False

Answers

Answer: true

Explanation:

Answer:

true

Explanation:

Examine the unbalanced equation.
KClO3 → KCl + O2
What is the best classification for the unbalanced equation's reaction?

A.) decomposition
B.) combustion
C.) displacement
D.) synthesis

Answers

The answer is A.) decomposition

Got a 100% Hope that helps

What is the complementary strand of DNA that is made during DNA replication if the template/parent strand of DNA reads ATG GGC CAT?
A. TAC CCG GTA
B. UAC CCG GUA
C. ATG GGC CAT
D. CGA AAT AGC

Answers

The answer to this is A. The complementary strands are A-T, T-A, G-C, C-G, and U-A

The complementary strand of DNA that is made during DNA replication if the template/parent strand of DNA reads ATG GGC CAT is TAC CCG GTA. Thus, the correct option for this question is A.

What is DNA replication?

DNA replication may be defined as a type of biological process through which two identical replicas of DNA form from one original DNA molecule. This process makes a copy of the DNA in a cell is made before the cell divides.

When it comes to the complementary strand of DNA, either of the two chains makes up a double helix of DNA, with corresponding positions on the two chains being composed of a pair of complementary bases.

For example, if Adenine A is present in the parental DNA, then it should be complementarily bounded to the thymine and vice versa. Similarly, if Cytosine is present in the parental strand of DNA, then it should be complementarily bounded by guanine and vice versa.

Therefore, the correct option for this question is A.

To learn more about DNA replication, refer to the link:

https://brainly.com/question/21265857

#SPJ2

Some fish that live in pitch-dark caves have things that look like eyes but do not see.

Are their eyes best described as an exaptation or a vestigial adaptation?

Answers

Answer:

It is adaptation

Explanation:

I had this question on my test last week

How do you know that energy and matter are conserved during the process of cellular respiration?

Answers

Answer:

Energy and matter are conserved in cellular respiration because it has identifiable inputs and outputs. These can be modeled with chemical equations.

Food undergoes chemical reactions in organisms to generate new molecules for growth or energy. Therefore, energy and atoms are conserved during cellular respiration.

What is conservation of energy and matter in cellular respiration?

The law of conservation of energy states that energy cannot be created or destroyed but can be changed from one form to another. The law of conservation of matter states that the total mass within a closed system that does not allow matter or energy to escape should remain constant. However, the law of conservation of energy states that energy can change from one form to another.

The process of cellular respiration is an example of a chemical reaction, which involves the transformation of one type of matter into another. A chemical equation describes this change in molecular structure. This is the cellular respiration chemical equation:

[tex]C_{6} H_{12} O_{6} + 6 O_{2} = > 6CO_{2} + 6H{2}0 + energy[/tex]

(Glucose + Oxygen yields Carbon Dioxide + Water + Energy)

Therefore, the amount of carbon dioxide atoms released by respiration is the same as the amount of  atoms in the oxygen and carbon that were changed.

Learn more about cellular respiration, here:

https://brainly.com/question/13721588

#SPJ2

What kingdom is the sting ray in?

Answers

Answer: they are found in Plesiobatis daviesi

Electrons fill energy levels starting with the levels __________________
(close to or away from) the nucleus.

Answers

I think it might be away

Electrons fill energy levels starting with the levels that are close to the nucleus. The levels are called orbitals and each orbital must be filled before the next orbital can be filled also the 1st orbital can only hold 2 electrons.

10 common wetland plants native to Georgia

Answers

Answer: its Georgia

Exampl:

what is the biodiversity score of farmland (maize)?

Answers

Answer:

Required Answer:-

The intensification of agriculture has caused dramatic declines in farmland biodiversity (Carvalheiro et al., 2013; Senapathi et al., 2015). Since the 1990s, agricultural policies have been developed in Europe to mitigate this loss through agri-environmental schemes (AES). One AES is “sown wildflower strips”, the aim of which is to create new ecological infrastructures by sowing attractive wild flowers on arable land (a few % of the cultivated area). These ecological infrastructures fall within our definition of MIMS since they represent a massive introduction of managed species in the landscape.

For the initial year of a summer camp, 56 girls and 64 boys enrolled. Each year thereafter, 18 more students enrolled in the camp. Let t be the time (in years) since the camp opened. Part A: Write a function rule for the total number of students enrolled t years after the camp opened.

Answers

Answer:

[tex]f(t)=120+18t[/tex]

Explanation:

We know that for the initial year of a summer camp, 56 girls and 64 boys enrolled.

The total children enrolled for the initial year can be calculated as :

[tex]56+64=120[/tex]

Each year, 18 more students enrolled in the camp.

The variable ''[tex]t[/tex]'' represents the time in years since the camp opened.

The following expression :

[tex]18t[/tex]  

represents the extra children enrolled each year

If we sum, we can obtain the following expression :

[tex]120+18t[/tex]

which is the function [tex]f(t)[/tex] for the total number of students enrolled [tex]t[/tex] years after the camp opened.

The function rule is [tex]f(t)=120+18t[/tex]

For example, when [tex]t=0[/tex] ⇒

[tex]f(0)=120+18(0)=120[/tex]

which is the original amount of enrolled children when the summer camp opened.

When [tex]t=3[/tex] ⇒

[tex]f(3)=120+18(3)=174[/tex]

which is the expected value for the total number of students enrolled 3 years after the camp opened.

A cell with two pairs of each set of chromosomes is called a diploid cell. These cells are typically found throughout the body tissues and are called [ germ / somatic ] cells.

Answers

the answer is somatic cells :)

Answer:

somatic

Explanation:

what is sexual reproduction​

Answers

Answer:

the production of new living organisms by combining genetic information from two individuals of different types (sexes). In most higher organisms, one sex (male) produces a small motile gamete which travels to fuse with a larger stationary gamete produced by the other (female).

Answer:

I think this answers you help u

What do cells need to do between divisions to make sure that they don’t just get smaller and smaller?

Answers

Answer:

The DNA must be copied so there is a full set of DNA to pass on to each daughter cell.

What would be the amino acid sequence for the mRNA strand AGGCAGUUG?

Answers

Answer:

please tell me if my answer is not helpful

Explanation:

Finish mRNA depletion & library generation in under 6.5 hours. Compatible with Illumina NGS systems. Request a sample. Higher success rates. Easier protocol. Includes cleanup beads. Includes adaptors. Feedback at each step. Lot to lot consistency.

please tell me if my answer is not helpful

Which statements best describe science? Check all that apply.
Science uses beliefs and opinions to construct explanations.
Science is resistant to new information.
Science is supported by facts and processes.
Science involves observation and experimentation.
Science continually changes and is constantly updated.

Answers

Answer:

3,4,5

Explanation:

The first two are false

Answer:

345

Explanation:

- The primary job of the mRNA molecule is to: *


Bring amino acids to the ribosome

Transcribe a message from a DNA molecule

Translate the codons into a protein​

Answers

Answer:

transcribe a message from a DNA molecule

Explanation:

What is the definition of Osmosis?

Answers

Answer:

a process by which molecules of a solvent tend to pass through a semipermeable membrane from a less concentrated solution into a more concentrated one, thus equalizing the concentrations on each side of the membrane.

Explanation:

Osmosis is a special case of diffusion. Water, like other substances, moves from an area of higher concentration to one of lower concentration. ... In this example, the solute cannot diffuse through the membrane, but the water can. Water has a concentration gradient in this system....!!!!!!!!!...!!!!!!

Which statement best explains the shape of these layers of rock?
O A. Stress caused by forces that pull on both sides of an area of the
crust made the rock melt.
O B. Stress caused by tectonic plates moving at a transform boundary
made the rock break.
O C. Stress caused by a collision between two tectonic plates made the
rock bend
O D. Stress caused by the weight of the upper layer of rock made the
rock tilt

Answers

Answer:

C. Stress caused by a collision.........made the rock bend.

Answer:

C. Stress caused by a collision between two tectonic plates made the rock bend

Explanation:

Welp help :( I need a very good explanation ​

Answers

Much of the Earth’s biodiversity, however, is in jeopardy due to human consumption and other activities that disturb and even destroy ecosystems. Pollution, climate change, and population growth are all threats to biodiversity. These threats have caused an unprecedented rise in the rate of species extinction. Some scientists estimate that half of all species on Earth will be wiped out within the next century. Conservation efforts are necessary to preserve biodiversity and protect endangered species and their habitats.

Explanation:

The way people use land can affect the levels of nutrients and pollution in soil. Any activity that exposes soil to wind and rain can lead to soil loss. Farming, construction and development, and mining are among the main activities that impact soil resources.Over time, many farming practices lead to the loss of soil.

And as for land ita the same we construct bulidings and dig mines it damages the land. And as land is imporatant for survival of all the of the biosphere we are definntelt responsible for it as well.

Our water resources face a host of serious threats, all of which are caused primarily by human activity. They include sedimentation, pollution, climate change, deforestation, landscape changes, and urban growth. And again it it affects the biodiversity of water preety badly. The marine animals suffer because of our causes.

Biomagnification occurs when the concentration of a pollutant increases from one link in the food chain to another (i.e. polluted fish will contaminate the next consumer and continues up a tropic food web as each level consumes another) and will result in the top predator containing the highest concentration levels. It starts a chain reaction originating from our doings.

pollutants accumlate in bodies of fishes beacuse, they eat unhygienic and non fishFriendly stuffs,it passes on to onother fish.

Humans have come to rely on fossil fuels to power cars and planes, heat homes, and run factories. Doing these things pollutes the air with carbon dioxide. Other greenhouse gases emitted by natural and artificial sources also include methane, nitrous oxide, and fluorinated gases. It leads to destroying of ozone layer in antartica and durther affecting the biodiversity of animals as well as of ourselves.

Biodiversity is the amount of variety of life on Earth. Healthy ecosystems and rich biodiversity: ... Increase ecosystem productivity; each species in an ecosystem has a specific niche—a role to play. Support a larger number of plant species and, therefore, a greater variety of crops. Even if a single animal is cut from the biodiversity( ie. Extinct) the whole of the food chain will collapse

Threats to Biodiversity. The greatest threat leading to the loss of biodiversity is the human race. As our population grows together with our need for food, water, industry, transportation, and home comforts, it takes over natural ecosystems and replaces them with unnatural.

Identify locations of critical wildlife habitat for species at risk and the threats to these areas. Where possible, eliminate threats and maintain natural areas. Leave critical wildlife habitat undisturbed, especially nesting and denning sites. Promote wildlife use by setting up bird and bat houses. And reduce the no of cars and automobiles there are. Avoid usimg of plastic and toxic substances as it causes further harm to biodiversity.

In the its our fault thw animals are close to extinction or alredy extinct. The least we can so is help to conserve and preserve our beautiful and diverse biodiversity.

:)

If the heart becomes damaged or weakened, how will this affect the body’s systems?


The circulatory system will not function well, which will affect all other body systems.


Only the circulatory and respiratory systems will be affected.


Only the nervous system will be unable to function.


The muscular system will strengthen the heart.

Answers

Explanation: your answer is A

Answer:

The circulatory system will not function well, which will affect all other body systems. A.

Explanation:

I did the quiz. hope that helped :)

help me with this please​

Answers

Answer:

A. Type of rose bush

B. The number of flowers on each bush

C. Sunlight ,Amount Of Water, Temperature

A LEAF IS GREEN BECAUSE……
HELP ME AND ILL PUT U ON BRAINLIEST !
- THANKYOU

Answers

The answer is definitely A

i do not tell a lie change into passive voice​

Answers

Answer:

let a lie not be told into passive voice

A cell is to a board game as ____________ is to the rule book.

Answers

Nucleus is to rule book

Why are organisms classified?
A. biologists use a system of classification to group organisms based on their size
B. biologists use a system of classification to group organisms based on their political view
C. biologists use a system of classification to group organisms based on their birth date
D. biologists use a system of classification to group organisms based on their similarities

Answers

The answer is D
:)))))

is blood blue in your veins and if not, why are your veins blue

Answers

Answer:

No blood is not blue

Explanation:

veins look blue because light has to penetrate your skin to illuminate them as blue.

Answer:

No your blood is not blue in your veins. Veins look blue because light has to penetrate the skin to illuminate them

Explanation:

My sister is a certified phlebotomist

All cells are able to continue living because of their ability to (1) produce food (2) excrete wastes (3) Produce offspring (4) Produce hormones​

Answers

Answer:

It is 1) produce food

Explanation:

I had this question on my test last week

A) what is a niche?
B) what is meant by the term 'ecosystem'?

Answers

Answer:

A niche is the “job” or role an organism plays in its community.

Ecosystem refers to a biological community of interacting organisms and their physical environment.

Explanation:

Other Questions
Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies 2. What are the two types of deeds that make up the hero's journey? what plan has been made for the HRD in nepal? I do not breathe, but I run and jump. I do not eat, but I swim and stretch. I do not drink, but I sleep and stand. I do not think, but I grow and play. I do not see, but you see me every day. What am I? Both pieces of writing attacked the practices of the Catholic Church. Yet one led to a complete break, while the other did not. What in Luthers words seems uncompromising, and what in Erasmus words leaves more room for reform? What is the main function of the small intestine?(use terms : villi, surface area,blood capillaries,why must large molecules be broken down, high concentration and low concentration.) can anyone just explain how to do a distant rate time problems because I'm confused about them -4/9 divided by 2/3 what would the answer be? (First to answer gets brainiest)What three languages did theRosetta Stone, discovered in AncientEgypt, contain?A. Arabic, Baltic, and EnglishB. hieroglyphic, English and SomaliC. hieroglyphic, demotic and EnglishD. hieroglyphic, demotic and Greek What enrionmental factor can people with pku control to prevent building up extra phenylalanine in thier brains "God lends a helping hand to the man who tries hard". Justify the quote with reference to the lesson Weathering the storm in ersama Read and choose the correct option to complete the sentence.Antes de viajar el viernes, voy a ________ la ropa en la maleta. (1 point) aempacar bhacer cplanificar dpoder Pls help me8th grade English