when+the+temperature+of+a+copper+penny+is+increased+by+100+c°,+its+diameter+increases+by+0.17%.+the+area+of+one+of+its+faces+increases+by:+

Answers

Answer 1

According to the Question the area of one of the penny's faces increases by 0.135% when its temperature is increased by 100°C.

When the temperature of a copper penny is increased by 100°C, its diameter increases by 0.17%. However, to determine the change in the area of one of its faces, we need to use the formula for the area of a circle, which is πr². Since the radius of the penny changes with the increase in temperature, we can use the formula for the change in area of a circle, which is 2πrΔr. Using the percentage change in diameter (0.17%), we can find the corresponding percentage change in radius (which is half the diameter) by dividing 0.17 by 2, which gives us 0.085%. We can then use this percentage to calculate the change in the area of one of the penny's faces as follows:

Change in area = 2πrΔr = 2π(0.5r)(0.085% of 0.5r)

= 0.00135πr²

Therefore, the area of one of the penny's faces increases by 0.135% when its temperature is increased by 100°C.

To know more about Faces  visit :

https://brainly.com/question/28376454

#SPJ11


Related Questions

Calculate the volume of this composite figure​

Answers

Answer:

v=l × b×h

= 8×6×5

=240 units³

1.3 Solve for x: 1.3.1 (3x - 1)(x + 2) = 7x + 5 1.3.2 2x-5 ≥ -(x + 1) 1.4 Solve for x and y simultaneously in: 6+ 2y - x = 0 and 3x - 2y -4 = 0​

Answers

The solution to the system of equations is {x = -1, y = -7/2}.

How to solve

1.3.1 Solve for x: (3x - 1)(x + 2) = 7x + 5

First, let's expand the left-hand side of the equation:

3x^2 + 6x - x - 2 = 7x + 5

Simplify to:

3x^2 + 5x - 2 = 7x + 5

Subtract 7x + 5 from both sides to set the equation to zero:

3x^2 - 2x - 7 = 0

This is a quadratic equation in the form [tex]ax^2 + bx + c = 0[/tex]. To solve it, we can use the quadratic formula, x = [-b ± [tex]\sqrt(b^2 - 4ac)] / 2a:[/tex]

[tex]x = [2 \sqrt((-2)^2 - 43(-7))] / 2*3\\x = [2 \sqrt(4 + 84)] / 6\\x = [2 \sqrt(88)] / 6\\\\x = [2 2\sqrt(22)] / 6\\x = 1/3 \sqrt(22)/3[/tex]

So the solution set for this equation is {x = 1/3 + sqrt(22)/3, x = 1/3 - sqrt(22)/3}.

1.3.2 Solve for x: 2x - 5 ≥ -(x + 1)

First, simplify the inequality:

2x - 5 ≥ -x - 1

Add x and 5 to both sides to isolate x:

3x ≥ 4

Divide by 3:

x ≥ 4/3

So the solution set for this inequality is {x | x ≥ 4/3}.

1.4 Solve for x and y simultaneously in: 6 + 2y - x = 0 and 3x - 2y - 4 = 0

Rearrange the first equation to x = 6 + 2y and substitute into the second equation:

3(6 + 2y) - 2y - 4 = 0

18 + 6y - 2y - 4 = 0

4y + 14 = 0

4y = -14

y = -14/4

y = -7/2

Substitute y = -7/2 into the first equation:

6 + 2(-7/2) - x = 0

6 - 7 - x = 0

-x = 1

x = -1

So the solution to the system of equations is {x = -1, y = -7/2}.

Read more about system of equations here:

https://brainly.com/question/13729904

#SPJ1

How do we do this? Please help, thanks.

Answers

Two possible expressions for the length and the width of the rectangle are:

length = x + 2width = x- 7How to find possible expressions for the length and width?

Remember that for a rectangle of length L and width W, the area is:

A = L*W

Here the area is given by the quadratic equation:

A = x² + 2x - 7x - 14

We can factorize this equation to get:

A = (x + 2)(x - 7)

Then we can define:

length = x + 2

width = x- 7

Learn more about quadratic equations at:

https://brainly.com/question/1214333

#SPJ1

Represent b' as a product of terms of the form b4 where j is a non-negative integer. Enter the answers in descending order. b^11 = b^2 ____ b^2 ____ b^2 ____

Answers

To represent b^11 as a product of terms of the form b^2, we can write it as (b^2)^5. This means that b^11 can be expressed as the product of five terms of the form b^2.

b^11 = (b^2) * (b^2) * (b^2) * (b^2) * (b^2)

In this representation, each term is b^2, and we have a total of five terms. By multiplying these terms together, we get b^11.

The exponent rule states that when we raise a power to another power, we multiply the exponents. In this case, (b^2)^5 means we multiply the exponent 2 by 5, resulting in b^10. Therefore, the product of five terms of the form b^2 gives us b^11.

Learn more about exponent rule here:

https://brainly.com/question/29390053

#SPJ11

find the area of the regular polygon hexagon with a radius of 5 in

Answers

The area of a regular hexagon can be calculated using the formula A = (3√3/2) * s^2, where A is the area and s is the length of each side.

In this case, the hexagon has a radius of 5 inches, so the length of each side can be found by multiplying the radius by 2 and dividing it by the square root of 3. Substituting the side length into the formula gives the area of the regular hexagon.

The formula for calculating the area of a regular hexagon is derived from its relationship to an equilateral triangle. The regular hexagon can be divided into six equilateral triangles, where the side length of the hexagon is equal to the base of each equilateral triangle.

The formula A = (3√3/2) * s^2 is a result of the area formula for an equilateral triangle, where s is the length of each side. In this case, the radius of the hexagon is given as 5 inches. To find the length of each side, we multiply the radius by 2 and divide it by the square root of 3. Substituting this value into the formula gives us the area of the regular hexagon.

Learn more about regular hexagons here: brainly.com/question/1694257

#SPJ11

If adding an additional input does not produce additional output, the slope of the production function at this point is: A) 1 B) ½C) 0 D) -1.

Answers

The correct answer is:  C) 0.  If adding an additional input does not result in any increase in output, it suggests that the production function has reached a point of diminishing returns or a maximum level of productivity. At this point, the slope of the production function is zero.

The slope of a production function represents the rate at which output changes with respect to changes in input. A positive slope indicates increasing output with additional input, while a negative slope implies decreasing output. However, a zero slope indicates that there is no change in output despite changes in input.

In this scenario, since adding an additional input does not generate any additional output, the production function has plateaued, and the slope is zero. This means that the production function has reached its maximum level of efficiency or capacity.

Therefore, the correct answer is:

C) 0

Learn more about slope here:

https://brainly.com/question/28151869

#SPJ11

Two fair dice are tossed, and the up face on each die is recorded. Find the probability of observing each of the following events:
A:{ The difference of the numbers is 2 or less }
B:{ A 6 appears on exactly one of the dice }
C:{ The sum of the numbers is even }
P(A)= ? P(B)= ? P(C)= ?

Answers

Two fair dice are tossed, and the up face on each die is recorded.

The probability of observing each of the given events: are

P(A) = 1/3

P(B) = 5/18

P(C) = 1/2

A: The difference of the numbers is 2 or less.

The favorable outcomes for event A are when the difference between the numbers on the dice is 2 or less. We can have the following outcomes:

(1,1), (1,2), (2,1), (2,2), (1,3), (3,1), (2,3), (3,2), (3,3), (4,4), (5,5), (6,6)

So, there are 12 favorable outcomes for event A.

The total number of possible outcomes when two dice are tossed is 6 * 6 = 36.

Therefore, the probability of event A, P(A), is 12/36 = 1/3.

B: A 6 appears on exactly one of the dice.

The favorable outcomes for event B are when a 6 appears on exactly one of the dice. We can have the following outcomes:

(6,1), (6,2), (6,3), (6,4), (6,5), (1,6), (2,6), (3,6), (4,6), (5,6)

So, there are 10 favorable outcomes for event B.

Again, the total number of possible outcomes is 6 * 6 = 36.

P(B), is 10/36 = 5/18.

Therefore, the probability of event B,

C: The sum of the numbers is even.

The favorable outcomes for event C are when the sum of the numbers on the dice is even. We can have the following outcomes:

(1,1), (1,3), (1,5), (2,2), (2,4), (2,6), (3,1), (3,3), (3,5), (4,2), (4,4), (4,6), (5,1), (5,3), (5,5), (6,2), (6,4), (6,6)

So, there are 18 favorable outcomes for event C.

Once again, the total number of possible outcomes is 6 * 6 = 36.

Therefore, the probability of event C, P(C), is 18/36 = 1/2.

To learn more about probability , refer below:

https://brainly.com/question/26703830

#SPJ11

Maria has a savings account that earns 5% simple interest each year. The account has $2,300. If Maria does not add or take out any money, how much interest will she earn in 3 years?

Answers

To calculate the interest earned by Maria in 3 years, we can use the simple interest formula:

Interest = Principal * Rate * Time

Given:

Principal (P) = $2,300

Rate (R) = 5% = 0.05 (as a decimal)

Time (T) = 3 years

Substituting these values into the formula, we have:

Interest = $2,300 * 0.05 * 3

Calculating the result:

Interest = $2,300 * 0.05 * 3

= $345

Therefore, Maria will earn $345 in interest over 3 years.

use the chain rule to find the indicated partial derivatives. w = xy yz zx, x = r cos(), y = r sin(), z = r; ∂w ∂r , ∂w ∂ when r = 4, = 2 ∂w ∂r = ∂w ∂ =

Answers

∂w/∂r = (y * yz * zx) * (∂x/∂r) + (x * yz * zx) * (∂y/∂r) + (x * y * zx) * (∂z/∂r)

∂w/∂θ = (y * yz * zx) * (∂x/∂θ) + (x * yz * zx) * (∂y/∂θ) + (x * y * zx) * (∂z/∂θ)

To find the partial derivative ∂w/∂r, we use the chain rule. We differentiate each term in the expression for w with respect to r, while considering the chain rule for each variable. Since x = r * cos(θ), y = r * sin(θ), and z = r, we find the partial derivatives (∂x/∂r), (∂y/∂r), (∂z/∂r), (∂x/∂θ), (∂y/∂θ), and (∂z/∂θ).

For ∂w/∂r, we differentiate each term with respect to r, resulting in (y * yz * zx) * cos(θ) + (x * yz * zx) * sin(θ) + (x * y * zx). Similarly, for ∂w/∂θ, we differentiate each term with respect to θ, resulting in (-y * yz * zx) * r * sin(θ) + (x * yz * zx) * r * cos(θ).

Given that r = 4 and θ = 2, we substitute these values into the respective expressions to obtain the numerical values for ∂w/∂r and ∂w/∂θ.

For more questions like Expression click the link below:

https://brainly.com/question/14083225

#SPJ11

In a situation where the dependent variable can assume only one of the two possible discrete values,a. we must use multiple regression. b. all the independent variables must have values of either zero or one. c. logistic regression should be applied. d. there can only be two independent variables.

Answers

In a situation where the dependent variable can assume only one of two possible discrete values, logistic regression should be applied. Therefore, the correct choice is option c.

When the dependent variable is binary or dichotomous, meaning it can take only two possible discrete values (such as "yes" or "no," "success" or "failure," etc.), logistic regression is the appropriate statistical technique to analyze the data. Logistic regression is specifically designed for modeling binary outcomes.

Multiple regression, option a, is not necessary in this case because the dependent variable is not continuous, and multiple regression is typically used when the dependent variable is continuous.

Option b, stating that all the independent variables must have values of either zero or one, is not universally true for all situations with a binary dependent variable. The values of independent variables in logistic regression can take various forms, including continuous, categorical, or binary.

Option d, claiming that there can only be two independent variables, is incorrect. The number of independent variables in logistic regression is not restricted to two; it can involve multiple independent variables, similar to multiple regression.

Therefore, the correct choice is option c: logistic regression should be applied when the dependent variable can assume only one of two possible discrete values.

Learn more about logistic regression here:

https://brainly.com/question/30401646

#SPJ11

Over summer vacation, Vincent has to read a novel for English class. He has decided to spend the same amount of time reading every day. The number of days it will take him to finish the book depends on how many hours he spends reading every day.
d = the number of days it will take Vincent to finish reading the book
h = the number of hours Vincent spends reading every day
Which of the variables is independent and which is dependent?
d is the independent variable and h is the dependent variable
h is the independent variable and d is the dependent variable

Answers

The independent variable is h, the number of hours Vincent spends reading every day, and the dependent variable is d, the number of days it will take Vincent to finish reading the book.

The independent variable is the variable that can be changed by the experimenter. In this case, Vincent can change the number of hours he spends reading every day. The dependent variable is the variable that is affected by the independent variable. In this case, the number of days it will take Vincent to finish reading the book depends on the number of hours he spends reading every day. For example, if Vincent spends 2 hours reading every day, it will take him 15 days to finish the book. If he spends 3 hours reading every day, it will take him 10 days to finish the book. The number of hours he spends reading every day (the independent variable) determines the number of days it will take him to finish the book (the dependent variable).

To know more about independent variable here : brainly.com/question/1479694

#SPJ11

The chocolate shop has a rectangular logo for their business that measures 21/2 feet tall with an area that is exactly the maximum area allowed by the building owner create an equation that could be used to determine L , the unknown side length of the logo

Answers

The equation for the Unknown logo side length maximum area is : A = (21/2) × W.

To determine the unknown side length, L, of the rectangular logo, we can set up an equation using the given information. Let's assume the width of the logo is W.

The area of a rectangle is given by the formula: A = length × width.

In this case, the area is said to be exactly the maximum area allowed by the building owner. So, we need to maximize the area, given the constraint that the height of the logo is 21/2 feet.

The equation for the area is: A = L × W.

From the given information, we know that the height (L) of the logo is 21/2 feet.

Therefore, the equation for the Unknown logo side length maximum area is : A = (21/2) × W.

For such more questions on Unknown logo side length.

https://brainly.com/question/31994510

#SPJ11

William had a six-sided dice numbered from 1 to 6. He rolled it a total of 50 times. It landed on an even number 23 times.

a) Work out the relative frequency of the dice landing on an even number. Give your answer as a decimal.
b) If the dice were fair, what would the theoretical probability of it landing on an even number be? Give your answer as a decimal.
c) Is the dice definitely biased or definitely not biased, or is it impossible to tell? Write a sentence to explain your answer.​

Answers

Answer:

Step-by-step explanation: A) Relative frequency is the number of times an event happens over a total number of events :

so, 23/50 = 0.23

B) As there's a 6 side on a die so there are 2 even numbers and 3 odd numbers, so the theoretical probability of landing on an even number would be 3/6 = 0.50

c)Since the die has an equal distribution of chance landing of an even or a odd number (3/6 for both ), hence the die is not biased.

Find the flux of the vector field F = (0,0,3) across the slanted face of the tetrahedron z = 5-x-y in the first octant. Normal vectors point upward. Set up the integral that gives the flux as a double integral over a region R in the xy-plane. SSF-n ds = SSO A (Type an exact answer.) The flux is (Simplify your answer.)

Answers

To find the flux of the vector field F = (0, 0, 3) across the slanted face of the tetrahedron, we need to calculate the surface integral over the region R in the xy-plane.

The equation of the slanted face of the tetrahedron is given by z = 5 - x - y. To determine the limits of integration for the double integral, we need to find the projection of the region R onto the xy-plane.

By setting z = 0 in the equation of the slanted face, we can solve for the corresponding values of x and y:

0 = 5 - x - y

x + y = 5

This equation represents a straight line in the xy-plane passing through the points (5, 0) and (0, 5). This line determines the bounds for the double integral.

The flux integral can be set up as follows:

Flux = ∬_R F · n dA

Here, F = (0, 0, 3) is the vector field, and n is the outward unit normal vector to the surface. Since the normal vectors point upward, we can take n = (0, 0, 1).

The double integral over the region R in the xy-plane becomes:

Flux = ∬_R (F · n) dA

    = ∬_R (0, 0, 3) · (0, 0, 1) dA

    = ∬_R 3 dA

Since the integrand is a constant, we can evaluate the double integral by finding the area of region R in the xy-plane and multiplying it by the constant:

Flux = 3 * Area(R)

To determine the area of region R, we can calculate the area of the triangle formed by the line x + y = 5. The vertices of this triangle are (0, 5), (5, 0), and the origin (0, 0).

Using the formula for the area of a triangle, we have:

Area(R) = (1/2) * base * height

        = (1/2) * 5 * 5

        = 12.5

Therefore, the flux of the vector field across the slanted face of the tetrahedron is given by:

Flux = 3 * Area(R)

    = 3 * 12.5

    = 37.5

To learn more about flux of the vector field , refer below:

https://brainly.com/question/32200342

#SPJ11

The function g(x) is exponential. It increases by a factor of 3 over every unit interval. The function g(x) has the value 9 when x=6.

Answers

If the function g(x) is exponential and it increases by a factor of 3 over every unit interval, we can express it in the form g(x) = a * 3^x, where 'a' is a constant.

Given that g(x) has the value 9 when x = 6, we can substitute these values into the equation:

9 = a * 3^6

To solve for 'a', we divide both sides of the equation by 3^6:

a = 9 / 3^6 = 9 / 729 = 1/81

Therefore, the function g(x) is given by g(x) = (1/81) * 3^x, where it increases by a factor of 3 over every unit interval and has the value 9 when x = 6.

To learn more about exponential function, refer below:

https://brainly.com/question/26130204

#SPJ11

The limit below represents a derivative f′(a). Find f(x) and a.limh→0 cos((π/2)+h)/hf(x)=a=

Answers

The given limit represents the derivative f′(a). The function f(x) can be determined by finding the antiderivative of the derivative function f′(x), and the value of a can be calculated by evaluating the given limit expression.

To find the function f(x), we need to find the antiderivative of f′(x). In this case, f′(x) is represented by cos((π/2)+h)/h. Integrating this function will give us f(x) up to an arbitrary constant. However, since the question asks us to find f(x) in terms of x, we can write f(x) as the definite integral from a constant c to x of f′(t) dt, where f′(t) is the given derivative function.

To calculate the value of a, we evaluate the given limit expression as h approaches 0. Plugging in h = 0 into the expression cos((π/2)+h)/h will result in an indeterminate form of 0/0. This suggests the application of L'Hôpital's rule, which states that for indeterminate forms, taking the derivative of the numerator and denominator and then evaluating the limit can often yield a determinate form. By applying L'Hôpital's rule, we differentiate the numerator and denominator separately and re-evaluate the limit.

In conclusion, finding f(x) requires integrating the given derivative function, and calculating the value of a involves using L'Hôpital's rule to evaluate the given limit expression.

Learn more about L'Hôpital's rule here:

https://brainly.com/question/29252522

#SPJ11

the financial statements of danielle manufacturing company report net sales of $750,000 and accounts receivable of $60,000 and $90,000 at the beginning and end of the year, respectively. what is the accounts receivable turnover for danielle? group of answer choices 5 times 8.3 times 10 times 12.5 times

Answers

The accounts receivable turnover for Danielle Manufacturing Company is 8.3 times. This indicates that on average, the company collects its accounts receivable 8.3 times throughout the year.

To calculate the accounts receivable turnover, we divide the net sales by the average accounts receivable. The average accounts receivable can be calculated by adding the beginning and ending accounts receivable and dividing the sum by 2.

In this case, the average accounts receivable is ($60,000 + $90,000) / 2 = $75,000.

Now, we divide the net sales of $750,000 by the average accounts receivable of $75,000 to get the accounts receivable turnover:

Accounts Receivable Turnover = Net Sales / Average Accounts Receivable

                                = $750,000 / $75,000

                                = 10 times.

Therefore, the correct answer is 10 times, not 8.3 times as initially stated.

Learn more about average here: https://brainly.com/question/8501033

#SPJ11

5. Mateo Ernesto is 71 years old. His IRA has a fair market value of $ 390838.04. His life
expectancy factor is 26.5. What is Mateo's required minimum distribution?

Answers

Answer: Mateo's required minimum distribution is $14,736.60.

Step-by-step explanation: RMD = IRA balance / life expectancy factor

Plugging in the numbers given:

RMD = $390838.04 / 26.5

RMD = $14,736.60

Crane Company issued $6100000 of 6% 10 year bonds on one of its interest dates for $5268500 to yield an effective annual rate of 8%. The effective interest method of amortization is to be used. How much bond interest expense (to the nearest dollar) should be reported on the income statement for the end of the first year?

Answers

The bond interest expense reported on the income statement for the end of the first year should be approximately $421,480.

For calculating the bond interest expense for the end of the first year using the effective interest method of amortization:

1: Determine the effective interest rate:

The effective annual rate is given as 8%. Since the bonds were issued at a discount (purchase price of $5,268,500 is less than the face value of $6,100,000), the effective interest rate will be higher than the coupon rate of 6%.

The effective interest rate is used to calculate interest expense over the life of the bond.

2: Calculate the annual interest expense:

The annual interest expense is calculated by multiplying the carrying value of the bond at the beginning of the period by the effective interest rate.

Carrying value = Face value of the bond - Accumulated amortization

For the first year, the carrying value at the beginning of the period is the same as the purchase price since no amortization has been recorded yet.

Annual interest expense = Carrying value at the beginning of the period * Effective interest rate

3: Calculate the amortization:

Amortization is the difference between the annual interest expense and the coupon payment. The difference is added to the bond carrying value, reducing the discount.

Amortization = Annual interest expense - Coupon payment

Finally, we can calculate the bond interest expense for the end of the first year:

1. Calculate the annual interest expense:

Annual interest expense = Carrying value at the beginning of the period * Effective interest rate

2. Calculate the amortization:

Amortization = Annual interest expense - Coupon payment

3. Calculate the bond interest expense:

Bond interest expense = Coupon payment + Amortization

Let's calculate these values using the information provided:

Face value of the bond = $6,100,000

Purchase price of the bond = $5,268,500

Coupon rate = 6%

Effective annual rate = 8%

Number of years = 10

1: Determine the effective interest rate:

Effective interest rate = 8%

2: Calculate the annual interest expense:

Carrying value at the beginning of the period = Purchase price = $5,268,500

Annual interest expense = Carrying value at the beginning of the period * Effective interest rate

Annual interest expense = $5,268,500 * 8% = $421,480

3: Calculate the amortization:

Coupon payment = Face value of the bond * Coupon rate

Coupon payment = $6,100,000 * 6% = $366,000

Amortization = Annual interest expense - Coupon payment

Amortization = $421,480 - $366,000 = $55,480

4: Calculate the bond interest expense:

Bond interest expense = Coupon payment + Amortization

Bond interest expense = $366,000 + $55,480 = $421,480

Therefore, the bond interest expense reported on the income statement for the end of the first year should be approximately $421,480.

To know more about bond interest expense refer here:

https://brainly.com/question/31785140#

#SPJ11

.Consider a biased coin that shows heads in 2/3 of all cases and tails only in 1/3 of all cases.
The coin is flipped consecutively (and independently) 200 times.


a) What is the probability that tails shows up the first time at the 10th flip?
b) Calculate the probability more than 150 times heads shows up (using a suitable
approximation).

Answers

P(X > 150) = P(Z > (150 - 400/3) / (20/3))

where Z is a standard normal random variable.

What is Probability?

Probability is a branch of mathematics concerned with numerical descriptions of how likely an event is to occur or how likely a statement is to be true. The probability of an event is a number between 0 and 1, where, roughly speaking, 0 indicates the impossibility of the event and 1 indicates a certainty

a) To calculate the probability that tails shows up for the first time at the 10th flip, we need to consider the sequence of flips leading up to the 10th flip.

The probability of getting tails on a single flip is 1/3, and the probability of getting heads is 2/3. Since the coin flips are independent events, the probability of getting tails on the first nine flips and then heads on the 10th flip is:

(1/3)^9 * (2/3) = 2^-9 * 3^-9

This is because the probability of getting tails on each of the nine flips is (1/3)^9, and the probability of getting heads on the 10th flip is 2/3.

Therefore, the probability that tails shows up for the first time at the 10th flip is approximately:

2^-9 * 3^-9 = 1/19683 ≈ 0.000051

b) To calculate the probability of more than 150 heads showing up using a suitable approximation, we can make use of the normal approximation to the binomial distribution.

In this case, we have 200 coin flips with a probability of heads occurring in each flip as 2/3. The expected number of heads is given by the product of the number of flips (200) and the probability of heads (2/3):

Expected number of heads = 200 * (2/3) = 400/3

The standard deviation of a binomial distribution is given by the square root of the product of the number of flips, the probability of success, and the probability of failure:

Standard deviation = sqrt(200 * (2/3) * (1/3)) = sqrt(400/9) = 20/3

To find the probability of more than 150 heads, we can approximate it as the probability of the number of heads being greater than 150 in a normal distribution with a mean of 400/3 and a standard deviation of 20/3.

Using a standard normal distribution table or a calculator, we can calculate the probability:

P(X > 150) = P(Z > (150 - 400/3) / (20/3))

where Z is a standard normal random variable.

By substituting the values and evaluating the expression, we can find the probability more than 150 heads shows up.

To learn more about Probability from the link below

https://brainly.in/question/49194822

#SPJ4

(a) What measures of variation indicate spread about the mean? (Select all that apply.) variance standard deviation coefficient of variation mean (b) Which graphic display shows the median and data spread about the median? 5-number summary histogram box-and-whisker plot frequency chart

Answers

Variance standard deviation coefficient of variation mean:

(a) The measures of variation that indicate spread about the mean are variance and standard deviation. Variance is the average squared deviation from the mean and provides an estimate of the degree of spread or dispersion of the data. Standard deviation is the square root of variance and is a commonly used measure of the spread of data. Coefficient of variation is also a measure of variation, which expresses the standard deviation as a percentage of the mean.

(b) The graphic display that shows the median and data spread about the median is the box-and-whisker plot. The box-and-whisker plot displays the five-number summary, which includes the minimum value, the first quartile, the median, the third quartile, and the maximum value. The box represents the middle 50% of the data and the whiskers show the range of the data outside the box. The median is represented by a line inside the box. The box-and-whisker plot is a useful tool for comparing distributions and identifying outliers.

To know more about Variance standard visit:

https://brainly.com/question/28660799

#SPJ11

8) Svetlana is trading her car in on a new car. The
new car costs $25,025. Her car is worth $6998.
How much more money does she need to buy
the new car?
A) $18,028
C) $18,027
B) $18,017
D) $17,927

Answers

The additional amount she needs to buy the new car is $18,027


Calculating how much more money she needs to buy the new car?

From the question, we have the following parameters that can be used in our computation:

The cost of the new car = $25,025.

The worth of the car now =  $6998.

Using the above as a guide, we have the following:

The amount needed is the difference between the above costs

So, we have

Difference = 25,025 - 6998

Evaluate

Difference = 18027

Hence, she needs $18,027 to buy the new car

Read more about expression at

https://brainly.com/question/15775046

#SPJ1

pleases someone help me with this I really need help only 4 problems I need help with

Answers

Answer:

i hope this halp you

Step-by-step explanation:

Find the area of the surface.The part of the planez = 6 + 2x + 5ythat lies above the rectangle[0, 7] × [1, 8]

Answers

To find the area of the surface that lies above the rectangle [0, 7] × [1, 8] and below the plane z = 6 + 2x + 5y, we can use double integration.

The surface is defined by the equation z = 6 + 2x + 5y. To find the area of this surface, we need to integrate over the rectangular region [0, 7] × [1, 8]. We can set up a double integral in terms of x and y to calculate the surface area.

The integral for the surface area is given by A = ∬R √(1 + (∂z/∂x)^2 + (∂z/∂y)^2) dA, where R represents the rectangular region [0, 7] × [1, 8], ∂z/∂x and ∂z/∂y represent the partial derivatives of z with respect to x and y, respectively, and dA represents the differential area element.

To evaluate the integral, we calculate the partial derivatives (∂z/∂x and ∂z/∂y), substitute them into the integrand, and integrate over the rectangular region R. This will yield the area of the surface that lies above the given rectangle.

Performing the necessary calculations and evaluating the double integral will give us the area of the surface.

Learn more about partial derivatives here:

https://brainly.com/question/28751547

#SPJ11

determine if v is an eigenvector of the matrix a . select an answer yes no 1. a=[−3−46−2−2−126−4−472000−3],v=[−1100] select an answer yes no 2.

Answers

Yes, v is an eigenvector of the matrix A.

No, v is not an eigenvector of the matrix A.

To determine if v is an eigenvector of matrix A, we need to check if the following equation holds: Av = λv, where λ is a scalar called the eigenvalue.

For the first question, we have A = [[-3, -4, 6], [-2, -2, 6], [-4, -7, 20]], and v = [-1, 1, 0]. Multiplying Av, we get Av = [-2, 2, 0], and multiplying λv, we get λv = [-λ, λ, 0]. To find the eigenvalue λ, we solve the equation Av = λv, which leads to λ = 2. Since Av = λv, we can conclude that v is an eigenvector of A.

For the second question, we have A = [[1, 2], [3, 4]], and v = [-1, 1]. Multiplying Av, we get Av = [-1, 1], and multiplying λv, we get λv = [-λ, λ]. To find the eigenvalue λ, we solve the equation Av = λv, which leads to λ = 3 or λ = -1. Since neither λ = 3 nor λ = -1 makes Av = λv true, we can conclude that v is not an eigenvector of A.

For more questions like Matrix click the link below:

https://brainly.com/question/29132693

#SPJ11

14. Joan surveyed her friends online to determine which current Philadelphia Eagles football players they wanted to meet. She asked them tom
player second, which player third, and so on.
Joan is creating her preference schedule and only has one column completed. If Joan uses the Borda count method, how many total poir
O
number of votes
1st
2nd
3rd
4th
25
50
100
Carson Wentz
Nick Foles
Nelson Agholor
Jason Kelce

Answers

In the completed column of Joan's preference schedule, Carson Wentz received 25 votes for 1st place, Nick Foles received 50 votes for 2nd place, Nelson Agholor received 100 votes for 3rd place, and Jason Kelce received 0 votes for 4th place. The total number of votes in this column is 175.

Joan surveyed her friends online to determine their preferences for meeting current Philadelphia Eagles football players. She asked them to rank the players from first to fourth. Joan is using the Borda count method to create her preference schedule. The preference schedule is as follows:

1st place:

Carson Wentz received 25 votes.

2nd place:

Nick Foles received 50 votes.

3rd place:

Nelson Agholor received 100 votes.

4th place:

Jason Kelce received 0 votes.

In total, there were 175 votes cast by Joan's friends.

for such more question on Borda count method

https://brainly.com/question/15012682

#SPJ11

The radioactive element polonium decays according to the law given below where Q0 is the initial amount and the time t is measured in days.
Q(t) = Q0 · 2-(t/140)
If the amount of polonium left after 700 days is 10 mg, what was the initial amount present?
________mg

Answers

The problem provides a decay law for the radioactive element polonium, where the amount of the element left after time t is given by Q(t) = Q0 · 2-(t/140), where Q0 is the initial amount.

The question asks us to find the initial amount of polonium present given that 10 mg of the element is left after 700 days. To solve this problem, we can substitute the given values into the decay law and solve for Q0. We can write the equation as 10 = Q0 · 2^(-700/140), and then simplify to 10 = Q0 · 2^(-5), or Q0 = 10 · 2^5 = 320 mg.

In summary, the problem provides a decay law for polonium and asks us to find the initial amount of the element given the amount left after a certain amount of time. By substituting the given values into the decay law and solving for Q0, we find that the initial amount of polonium present was 320 mg.

To learn more about Polonium : brainly.com/question/5048860

#SPJ11

how to slove 12(8-4×)+3×=634 ?



Answers

Answer: x= 11 43/45 or decimal form x=-11.9

Step-by-step explanation:

12(8-4×)+3×=634

You start by

12x(4x)+3x=634

48x+3x=634

51x=634

634 divided 51=12.431372549

X=12.431372549

The data below consists of the test scores of 32 students. Construct a 99% confidence interval for the population mean:
80 74 61 93 96 70 80 64 51 98 93 87 72 77 84 96 100 67 71 79 99 85 66 70 57 75 86 92 94 70 81 89

Answers

The confidence interval for the population mean is 72.05036, 90.38714

Confidence interval = sample mean ± (critical value) × (standard deviation / √(sample size))

Test scores of 32 students at a 99% confidence level.

Mean = Summing of all the test scores /sample size

80 + 74 + 61 + 93 + 96 + 70 + 80 + 64 + 51 + 98 + 93 + 87 + 72 + 77 + 84 + 96 + 100 + 67 + 71 + 79 + 99 + 85 + 66 + 70 + 57 + 75 + 86 + 92 + 94 + 70 + 81 + 89 = 2599

Sample mean = 2599 / 32 = 81.21875

For standard deviation

The sum of squared deviations from the sample mean:

(80 - 81.21875)² + (74 - 81.21875)² + ... + (89 - 81.21875)² =

divide the sum by the sample size -1 and take the square root

√(12774.5625 / (32 - 1)) = √(400.4545455) = 20.011

Standard deviation = 20.011

The critical value for a 99% confidence level is approximately 2.617.

Putting the values into the formula

Confidence interval = 81.21875 ± (2.617) × (20.011 / √(32))

Calculating the square root of the sample size

√(32) = 5.656854249

Confidence interval = 81.21875 ± (2.617) × (20.011 / 5.656854249)  Confidence interval = 81.21875 ± 9.16839

The lower bound of the confidence interval is approximately 72.05036, and the upper bound is approximately 90.38714.

Therefore, the 99% confidence interval for the population mean is approximately (72.05036, 90.38714).

To know more about Confidence intervals click here :

https://brainly.com/question/31321885

#SPJ4

Over the circle x^2 + y^2 < r^2 random variables X and Y have a uniform PDF

f X,Y(x,y) = 1/(Pi r^2) , x^2 + y^2 < r^2

0 otherwise

b) what is marginal PDF fx(x)?

c) what is marginal PDF fy(y)?

Answers

b)The marginal PDF fx(x) is given by: fx(x) = ([tex]2\sqrt{(r^2 - x^2))/(\pi r^2}[/tex]), for -r < x <r

c) the marginal PDF fy(y) is given by: fy(y) = ([tex]2\sqrt{(r^2 - y^2))/(\pi r^2}[/tex]), for -r < y < r

To find the marginal probability density functions (PDFs) fx(x) and fy(y) from the joint PDF fX,Y(x, y), we need to integrate the joint PDF over the appropriate range.

b) To find the marginal PDF fx(x), we integrate fX,Y(x, y) with respect to y while considering the range of x:

fx(x) = ∫fX,Y(x, y) dy

Since the joint PDF is defined over the circle [tex]x^2 + y^2 < r^2[/tex], the integration limits for y will be -[tex]\sqrt{r^2 - x^2)}[/tex] to [tex]\sqrt{r^2 - x^2)}[/tex]

fx(x) = ∫[tex][-\sqrt{(r^2 - x^2)}[/tex], [tex]\sqrt{(r^2 - x^2}[/tex])] (1/(πr^2)) dy

Integrating, we get:

fx(x) = ([tex]1/(\pi r^2)[/tex]) * 2[tex]\sqrt{(r^2 - x^2}[/tex]

Therefore, the marginal PDF fx(x) is given by:

fx(x) = (2[tex]\sqrt{(r^2 - x^2}[/tex]/([tex]\pi r^2[/tex]), for -r < x < r

c) Similarly, to find the marginal PDF fy(y), we integrate fX,Y(x, y) with respect to x while considering the range of y:

fy(y) = ∫fX,Y(x, y) dx

Since the joint PDF is defined over the circle[tex]x^2 + y^2 < r^2[/tex], the integration limits for x will be -[tex]\sqrt{r^2 - y^2}[/tex]) to [tex]\sqrt{(r^2 - y^2}[/tex]).

fy(y) = ∫[-[tex]\sqrt{r^2 - y^2}[/tex], √[tex]\sqrt{r^2 - y^2}[/tex]] ([tex]1/(\pi r^2[/tex])) dx

Integrating, we get:

fy(y) = (1/[tex](\pi r^2[/tex])) * 2[tex]\sqrt{r^2 - y^2}[/tex])

Therefore, the marginal PDF fy(y) is given by:

fy(y) = [tex]2\sqrt{(r^2 - y^2))/(\pi r^2}[/tex] for -r < y < r

For more such questions on marginal PDF visit:

https://brainly.com/question/30196350

#SPJ11

Other Questions
explain briefly the negative impact of lack of information in a business. When choosing the right amount of a public good to supply, the government: A) often fails to provide it, because people have an incentive to understate a good's value. B) often guesses, because people have an incentive to overstate a good's value. C) often provides too much, because people have an incentive to understate a good's value. D) often provides too little, because people have an incentive to overstate a good's value. to relate two fields in a one-to-many relationship, you connect them using a _____. 2. draw an arrow-pushing mechanism to show how we create our product (4-nitrobromobenzene, the ortho product) Specific phobia differs from generalized anxiety disorder in which of the following ways?a: specific phobia is linked to a particular stimulus, whereas generalized anxiety disorder is notb: generalized anxiety disorder is linked to a particular stimulus, whereas specific phobia is notc: a specific phobia is not very upsetting for the suffer, whereas generalized anxiety disorder isd: generalized anxiety disorder is not very upsetting for the sufferer, whereas specific phobia ise: generalized anxiety disorder is classified as s one of the anxiety disorders, whereas specific phobia is not Santiago is a Mexican student and Pierre is an Egyptian student in an exchange program.Both are part of a team competing in an international quiz competition,and they prepare very hard and cooperate with each other despite their cultural differences.This scenario most likely exemplifies the importance of ________ in bringing interracial harmony.A)implicit self-esteemB)a superordinate goalC)pluralistic ignoranceD)the jigsaw technique Using PCR, you wish to amplify the region of interest (bolded) in the DNA sequence below.|-----Region of interest-----|5 ATAGGTGCAGCCATGAGTACCAATATATC . . . GCTCGAGATCGACTACGCGGCTCTCAGC 33 TATCCACGTCGGTACTCATGGTTATATAG . . . CGAGCTCTAGCTGATGCGCCGAGAGTCG 5Which of the following primers would allow for its amplification? Select all that apply.a. Primer 1: 5-CCATGAGT-3b. Primer 2: 5-TGATGCGC-3c. Primer 3: 5-ACTACGCG-3d. Primer 4: 5-CGCGTAGT-3 a giant step is taken toward improving ethical performance throughout the company when: the primary reason why individuals are willing to pay entrepreneurs to organize production is consider the following setup: your car requires a new set of tires, to get the tires changed you take three hours off work (which reduces your total pay for the day by $60) and take your car to a mechanic who chargers you $240 for the tires and the work. what is the implicit cost of getting your tires changed? question 6 options: 60 240 300 please send me the answers how to declare two dimensional array using pointers in c++ in vertical exchange, direct and indirect materials in one industry are purchased on an as-needed basis. which of the following is not true about political culture? culture can affect a nation's approach to policy choices. politicians can use culture as a powerful tool to achieve political ends. culture becomes an issue as countries struggle to deal with the issue of cultural ownership. culture can explain nearly all the differences among nations. a researcher records age in years ( x ) and systolic blood pressure ( y ) for volunteers. a regression analysis was performed. a portion of the computer output is: question content area a series of equal cash flows at fixed intervals is termed a(n) a. cash flow b. level index c.annuity d.present value index when immobilizing an injured child in a pediatric immobilization device, you should: it is typical for children to begin seeing pubertal changes in their bodies between ages 8 and 14.. TRUE/FALSE Over five years, GDP in a nation increased from $10 trillion to $15 trillion, while the GDP price deflator increased from 100 to 125. Approximately how much is GDP in year five, stated in terms of year-one dollars?a. $12 trillionb. $16 trillionc. $14 trilliond. $19 trillionGDP Deflator:It is an economic measure that helps to build a comparison between the real economic activities during different years. It is also used to calculate the level of inflation in the economy. It is required to design a digital filter composed of a number of identical first order digital allpass filters connected in series to meet the following specifications: A constant magnitude response of 36.1236 dB. A sampling frequency of 100 kHz A phase response of -136.5(degrees) at a frequency of f = 5 kHz (a) Explore the possible designs for the system (number of stages needed, the position of poles with respect to the unit-circle, etc.).(b) Find the poles and zeros of the allpass so you can judge what is the best choice. (c) Plot the magnitude, phase, and group delay responses (freq. in kHz) to verify your results. (d) Write the difference equation of the overall system. How many multiplications per second is needed? (e) Plot the step response and transient response of the overall system.