which artist/band started out as "country rock" genre before moving on to mainstream success?

Answers

Answer 1

One of the most well-known examples of an artist/band that started out as a "country rock" genre before moving on to mainstream success is the Eagles.

Formed in Los Angeles in 1971, the Eagles blended traditional country music with rock and roll, creating a unique sound that helped define the "country rock" genre. Their debut album, "Eagles," released in 1972, included hit songs like "Take it Easy" and "Peaceful Easy Feeling." However, it was their 1976 album "Hotel California" that propelled them to mainstream success, earning them a Grammy Award and becoming one of the best-selling albums of all time. The Eagles continued to dominate the charts throughout the 70s and 80s, cementing their status as one of the most successful bands of all time.

To know more about country rock visit:

https://brainly.com/question/28523110

#SPJ11


Related Questions

What did Schubert work as before he devoted himself entirely to music?

Answers

Schubert worked as a schoolteacher for a short period of time before he devoted himself entirely to music. However, his love for music had always been present, and he began composing at a young age.

Despite his brief stint as a teacher, Schubert's passion for music led him to eventually pursue it as a career. He wrote over 600 compositions, including symphonies, chamber music, operas, and songs, making him one of the most prolific composers of his time. Schubert's work had a significant impact on the music world, and his compositions continue to be admired and studied today. Schubert's love for music and his dedication to his craft have left a lasting impression on the world of classical music.

To know more about Schubert visit:

https://brainly.com/question/25246565

#SPJ11

style of matching observation with the artist’s feelings in an abstracted application of line, shape, space, and color?

Answers

The style of matching observation with the artist's feelings in an abstracted application of line, shape, space, and color. The style you're referring to is called "Abstract Expressionism." Abstract Expressionism is an art movement that focuses on conveying emotions and concepts through abstract representations of line, shape, space, and color.

Artists who practice this style often rely on their personal experiences and emotions to create unique, non-objective compositions. Observation: The artist observes their surroundings, thoughts, or emotions. Abstraction: The artist simplifies and abstracts their observations, focusing on essential elements like line, shape, space, and color. Expression: The artist uses these abstract elements to express their feelings or concepts in their artwork.

Application: The artist applies the abstract elements to their artwork, often using various techniques like brushstrokes, layering, and texture. In summary, Abstract Expressionism is a style that matches observation with the artist's feelings through the abstracted application of line, shape, space, and color.

To know more about Abstract visit:-

https://brainly.com/question/28523459

#SPJ11

another dramatic way to present the illusion of motion in art is to ________ the figure.

Answers

Another dramatic way to present the illusion of motion in art is to elongate the figure. This technique is called foreshortening, and it involves distorting the proportions of the figure to create the illusion of depth and movement.

By exaggerating the length of certain body parts and compressing others, the artist can create a sense of motion and action within the composition. This technique is commonly used in dynamic poses, such as figures in mid-leap or in the midst of a fight. Foreshortening requires a strong understanding of anatomy and perspective, as well as careful observation of the natural world. It can be a challenging technique to master, but when executed well, it can add a powerful sense of drama and excitement to a work of art.

To know more about foreshortening visit:

https://brainly.com/question/29233426

#SPJ11

Television series' Breaking Bad, Orange Is the New Black, and Mad Men are all part of what?

Answers

The television series Breaking Bad, Orange Is the New Black, and Mad Men are all part of the "Golden Age of Television" or the "Peak TV" era. This period of time began in the early 2000s and is characterized by an increase in quality and quantity of original scripted television content.

These shows, along with others like The Sopranos, Game of Thrones, and The Wire, are considered some of the greatest television shows of all time. They all feature complex characters, intricate storylines, and high production value. This era has also been marked by the rise of streaming platforms like Netflix and Hulu, which have allowed for more diverse and experimental storytelling. Overall, the Golden Age of Television has redefined what is possible on the small screen and has elevated television to a level of prestige that was once reserved for film.

To know more about television visit:

https://brainly.com/question/16925988

#SPJ11

why do you think studyart history is so important? what can it tell us about past cultures

Answers

Art history is important as it offers insights into past cultures and civilizations by serving as a visual record of their beliefs, values, and experiences.

Why is the  study of art history is so important?

Studying art history reveals cultural insights and techniques from different societies across history. Art reflects history, reflecting political, social, and economic conditions.

Analyzing artwork illuminates the complexities of the past. Art visually documents history, people, and places, offering a unique viewpoint and filling knowledge gaps.

Learn more about art history from

https://brainly.com/question/4431796

#SPJ1

in his study of the effects of a 14-week program of cooperative games, orlick found that

Answers

Dr. Orlick's study of the effects of a 14-week program of cooperative games revealed that participants experienced positive changes in their social skills, attitudes, and behaviors.

The program emphasized cooperation and teamwork rather than competition, and participants were encouraged to communicate effectively, solve problems collaboratively, and support one another. These cooperative games helped to build trust and empathy among participants, which translated into improved relationships with family members, friends, and peers. Additionally, participants reported feeling more confident, empowered, and responsible for their actions. These findings suggest that cooperative games can be an effective tool for promoting positive social development and improving mental health outcomes. Overall, Dr. Orlick's study highlights the importance of incorporating cooperative games into educational and therapeutic settings to support the holistic well-being of individuals.

To know more about Orlick visit:

https://brainly.com/question/13669649

#SPJ11

which of the following would not be a helpful audio visual aid for a presentation on drought

Answers

The correct answer is Option D. A live demonstration of water conservation techniques would not be a helpful audio-visual aid for a presentation on drought.

While live demonstrations can be engaging and informative in certain contexts, they may not be suitable for a presentation on drought, which primarily focuses on explaining the causes, impacts, and potential solutions to drought conditions. A live demonstration may not effectively convey the broader concepts and information related to drought, and it may be challenging to replicate the conditions and context of a drought situation during a live presentation.

Instead, visual aids such as graphs, videos, demonstrations, and maps can provide clear and concise information that enhances the audience's understanding of drought and its implications.

To learn more about conservation techniques, visit here

https://brainly.com/question/31843500

#SPJ4

Which of the following would not be a helpful audio-visual aid for a presentation on drought?

a. A graph showing the decline in precipitation over the past decade

b. A video showcasing the effects of drought on agriculture and livestock

c. A detailed map illustrating regions currently affected by drought

d. A live demonstration of water conservation techniques

an organist controls various sets of pipes by pulling knobs called pipes. stops. valves. bellows.

Answers

Answer: An organist controls various sets of pipes by pulling knobs called stops.

Traditional music of the Middle and Far East is typically polyphonic. True/False

Answers

False. Traditional music of the Middle and Far East is typically monophonic, not polyphonic.

Traditional music in the Middle East and Far East, such as in regions like India, China, and the Arab world, is predominantly based on monophonic melodies rather than polyphonic textures. Monophonic music consists of a single melodic line without any accompanying harmonies or additional voices. This style of music emphasizes the melodic aspect and often incorporates intricate ornamentation and improvisation. Examples include the maqam system in Arabic music, the raga system in Indian classical music, and various traditional folk music traditions across the Middle and Far East.

Polyphonic music, on the other hand, involves the simultaneous sounding of multiple independent melodies or voices. This style of music is more commonly found in Western classical music traditions and certain folk music traditions. The use of harmony and counterpoint is a distinguishing feature of polyphonic music.

In summary, traditional music of the Middle and Far East is typically monophonic, focusing on the richness of the melodic line rather than complex harmonies or multiple voices.

To learn more about Monophonic music click here: brainly.com/question/29790907


#SPJ11

the artist vasily kandinsky wanted to ________ in such artworks as improvisation #30.

Answers

The artist Vasily Kandinsky wanted to express inner feelings and emotions in such artworks as Improvisation #30.

Kandinsky was a pioneering abstract artist who believed that art should be a means of expressing inner experiences and emotions rather than simply representing external reality. He believed that color and form could be used to create powerful emotional responses and that art should be a spiritual experience for both the artist and the viewer. Improvisation #30 is a striking example of Kandinsky's abstract style, with its bold colors and fluid forms that seem to suggest movement and energy.  

Learn more about Kandinsky's abstract style,

https://brainly.com/question/31819632

#SPJ4

Distinguishing major from minor characters is an analysis of which of the following? 1) style 2) historical period 3) relationships 4) status and personality

Answers

Distinguishing major from minor characters is an analysis of the status and personality of each character.

Major characters are those who have a significant impact on the plot and are typically more fully developed and complex in their personalities. Minor characters, on the other hand, serve more as supporting roles and are often less developed or have less of an impact on the plot. This analysis can be helpful in understanding the structure and dynamics of a story, as well as the roles that each character plays in driving the plot forward. It can also help readers to identify the themes and motifs that are present in a work of literature, as major and minor characters often serve different symbolic functions. In order to fully understand a story, it is important to pay attention to both major and minor characters and the roles they play.  we can conclude that distinguishing major from minor characters is an essential part of literary analysis, as it can provide insight into the structure, themes, and symbolism of a story.

To know more about minor characters visit:

https://brainly.com/question/26156578

#SPJ11

Answer: Relationships

Explanation:

The Textbook says: costumes should also show relationships among characters, separating major characters from minor ones and contrasting one group with another.

What are the characteristics of contour lines in drawing .

Answers

Contour lines in drawing have several distinct characteristics:

What are the characteristics of contour lines in drawing .

Definition: Contour lines define the outer edges or boundaries of an object or a figure, as well as significant changes of plane within the object.

Outline and Detail: They can be used to draw both the outline of an object and details within it.

Perspective and Depth: By varying the thickness and darkness of contour lines, artists can suggest perspective and depth, making the object appear three-dimensional.

No Shading: Contour lines typically do not include shading or color; they focus on the shape and structure of the object.

Continuity: In pure contour drawing, the artist draws the object without lifting the pencil from the paper, creating a continuous line.

Read more on contour lines here https://brainly.com/question/13088900

#SPJ1

what is "flight" by alfred schnittke is about?

Answers

Answer: The “flight” by Alfred schnittke is about Fairy tale of wandering.

Explanation:

In "Young Goodman Brown", what ritual does the devil attempt to perform in the woods, with Goodman Brown as the object?

Answers

In "Young Goodman Brown," the devil attempts to perform a ritual in the woods with Goodman Brown as the object. Specifically, the devil wants to initiate Goodman Brown into the community of sinners who gather in the woods.

The ritual involves a ceremony in which Goodman Brown would be officially welcomed into the group of sinners and become a member of the community. The devil attempts to convince Goodman Brown to join the group by telling him that his ancestors, including his grandfather, were all members of the community and that it is a tradition that he should uphold. The devil also tells Goodman Brown that he will see many respected members of the community, including his own religious leaders, participating in the ritual. Ultimately, Goodman Brown resists the temptation and refuses to join the group, but the experience leaves him with a profound sense of doubt and skepticism about the morality of those around him.

To know more about ritual visit:

https://brainly.com/question/12799934

#SPJ11

the star of which sitcom shares his last name with a common type of wrench?

Answers

The sitcom you are referring to is "Home Improvement." The star of this show, Tim Allen, plays the character Tim Taylor. The last name "Taylor" is also a common type of wrench known as a Taylor wrench, which is a popular tool in various industries.

"Home Improvement" is an American television sitcom that aired from 1991 to 1999. It revolves around Tim Taylor, who is a TV show host and a loving father and husband. The show focuses on Tim's daily trials and tribulations as he balances his personal life with his job hosting a home improvement show called "Tool Time."

A Taylor wrench is a type of adjustable wrench used for tightening or loosening nuts and bolts. It's a versatile tool, and its adjustable head makes it suitable for a wide range of applications. This wrench is commonly found in automotive repair, plumbing, and general maintenance tasks. Its connection to the sitcom character's last name highlights the show's focus on tools and home improvement projects.

In summary, the sitcom "Home Improvement" stars Tim Allen as Tim Taylor, whose last name is shared with a common type of wrench called the Taylor wrench. This connection between the character and the tool is fitting for a show that revolves around home improvement projects and the use of various tools.

Know more about Taylor wrench here:

https://brainly.com/question/12950264

#SPJ11

which animals from george orwell’s animal farm are standing on two legs by the end of the novel?

Answers

In George Orwell's novel Animal Farm, the pigs are the animals who are standing on two legs by the end of the novel.

The novel is a political allegory that tells the story of a group of farm animals who rebel against their human farmer and establish a government run by animals. The pigs, who take on the leadership roles, gradually become corrupted by power and begin to resemble their former human oppressors. By the end of the novel, the pigs are indistinguishable from humans, wearing clothes and walking upright on two legs. This transformation is a commentary on the corrupting influence of power and the dangers of totalitarianism. Overall, the novel is a powerful critique of political systems that exploit and oppress the vulnerable.

To know more about George Orwell visit:

https://brainly.com/question/875183

#SPJ11

what technique involves attaching hair wefts or single strands with adhesive or glue?

Answers

The answer would be bonding.

The technique that involves attaching hair wefts or single strands with adhesive or glue is called hair extension bonding.

This method involves using a special adhesive or glue to attach the extensions to natural hair strands, creating a seamless and natural look. The process begins by sectioning the hair, applying the adhesive to the weft or single strands, and then attaching them to the natural hair strands. Bonding can be a time-consuming process, but it can last for several weeks before needing to be redone. However, it is important to note that bonding can damage natural hair if not done correctly, so it is important to consult with a professional stylist who has experience with this technique. Additionally, proper care and maintenance of the extensions are necessary to ensure they stay in good condition and do not cause any damage to the natural hair.

To know more about adhesive visit:

https://brainly.com/question/32111106

#SPJ11

what northern renaissance artist traveled to italy and attempted to fuse italian ideas and discoveries with the northern love of meticulous observation?

Answers

Albert Durer northern renaissance artist traveled to Italy and attempted to fuse Italian ideas and discoveries with the northern love of meticulous observation.

Dürer was profoundly influenced by his trip to Italy; The majority of his subsequent decade's drawings, paintings, and graphics show both direct and indirect echoes of Italian art. While in Venice and maybe likewise before he went to Italy, Dürer saw etchings by aces from focal Italy. He was most influenced by Florentine artist Antonio Pollaiuolo, who was known for his sinuous, energetic line studies of the human body in motion, and Venetian artist Andrea Mantegna, who was known for his meticulous linear articulation of the human figure and attention to classical themes.

As a journeyman, Dürer probably traveled to the Netherlands, Alsace, and Basel, Switzerland, where he completed St. Jerome Curing the Lion, his first authenticated woodcut. Dürer spent a brief period of time in Strasbourg in 1493 or 1494 before returning to Basel to create several book illustrations. A self-portrait with a thistle painted on parchment in 1493 is one of the earliest works of art from this era.

Learn more about Albert Durer:

https://brainly.com/question/26036373

#SPJ4

Is polyrhythm associated with the ewe people of togo benin and ghana?Polyrhythm is associated with the Ewe people of Togo, Benin, and Ghana. Some composers developed minimalism and a style eventually called process music. Steve Reich's early phase works were meant to be performed by live musicians. was valued by musicians for new expressive avenues.

Answers

Yes, polyrhythm is indeed associated with the Ewe people of Togo, Benin, and Ghana.

The Ewe people have a rich musical tradition that includes complex rhythms and polyrhythms that are played on various drums and percussion instruments. This style of music has also influenced modern Western music, as some composers have incorporated elements of Ewe rhythms into their own compositions. For example, Steve Reich, an American composer, was heavily influenced by Ewe music and incorporated polyrhythms into his early works, such as "Drumming" and "Music for 18 Musicians". This style of music, which emphasizes complex rhythms and repetitive patterns, has been valued by musicians for its innovative and expressive qualities.

To know more about polyrhythm visit:

https://brainly.com/question/30163182

#SPJ11

an interest in folklore and folk music resulted from the rise of nationalism.T/F

Answers

True.

The rise of nationalism did indeed contribute to an increased interest in folklore and folk music. As nations sought to establish and strengthen their cultural identities, there was a growing fascination with the traditional customs, stories, and music of the common people.

During the 19th and early 20th centuries, many European nations underwent significant political and social changes, including movements towards independence and the formation of nation-states. This period witnessed a surge in national pride and a desire to assert and preserve unique cultural heritages. Folklore and folk music, with their roots in the rural and working-class communities, were seen as authentic expressions of national identity. Scholars, artists, and musicians began collecting and studying folk tales, songs, dances, and customs, aiming to preserve and promote their nation's cultural heritage.

Nationalist composers, in particular, drew inspiration from folk music traditions to create works that reflected the spirit and character of their respective countries. By incorporating elements of folk music into their compositions, these composers sought to evoke a sense of national pride and to connect with their audiences on a deeply cultural and emotional level.

Overall, the rise of nationalism fostered a renewed interest in folklore and folk music as a means to celebrate and reaffirm national identities.

To learn more about folk music click here: brainly.com/question/9993380

#SPJ11

what was the purpose of the ""quality control"" meetings at motown?

Answers

The purpose of the "quality control" meetings at Motown was to review and assess the songs recorded by the artists and ensure that they met the high standards set by the record label.

These meetings were led by Berry Gordy, the founder of Motown, and involved various key figures in the production process, including producers, songwriters, and executives. During the meetings, the songs were critically evaluated for their potential commercial success, lyrical content, melody, arrangement, and overall quality.

This rigorous quality control process aimed to maintain the consistent and distinctive sound that Motown was known for, ensuring that only the best songs were released to the public.

To learn more about quality control, visit here

https://brainly.com/question/30485550

#SPJ4

who was the only person to have a spoken line in mel brooks' "silent movie"?

Answers

The only person to have a spoken line in Mel Brooks' "Silent Movie" was legendary actor, mime, and comedian Marcel Marceau.

Marceau appeared as "Mime Marcel" in the film, and his line consisted of the single word "Non!" when Mel Brooks asked him if he wanted to be in the movie. Marceau had previously worked with Mel Brooks in the film "The Twelve Chairs" and was well-known for his silent film style of comedy.

His appearance in "Silent Movie" was brief but memorable and cemented his place in the film as an iconic figure. His single line was all that was needed to make the film, as it brought an element of hilarity and absurdity that was emblematic of a Mel Brooks production.

To know more about actor, click here:

https://brainly.com/question/31100253

#SPJ4

the _____ braid is a three-strand braid that is created with an underhand, or plaiting, technique.

Answers

Option D. The visible braid, also known as the three-strand braid, is a classic hairstyle created using an underhand, or plaiting, technique. This versatile braid style is popular and widely recognized for its simple yet elegant appearance.

To create a visible braid, start by dividing the hair into three equal sections. Hold one section in each hand, while the middle section remains between the other two. The plaiting technique involves crossing the outer sections over the middle section, alternating sides as you go. This process is repeated until you reach the end of the hair, securing it with an elastic band or hairpin.

The visible braid is commonly worn as a casual everyday hairstyle or can be adorned and styled for more formal occasions. It is suitable for various hair lengths and types, making it a versatile choice. Additionally, the braid can be customized by adjusting the tension, width, and placement, allowing for personal creativity and experimentation.

Whether you choose to wear it loose or incorporate it into an updo, the visible braid adds a touch of charm and sophistication to any look. Therefore the correct option is D

The Question was Incomplete, Find the full content below :

The ______ braid is a three strand braid that is created with an underhand, or plaiting technique.

A. fishtail

B. box

C. inverted

D. visible

Know more about visible braid here:

https://brainly.com/question/31915878

#SPJ11

when giving a speech of recognition while presenting someone with an award ofr gift, the speaker should

Answers

When giving a speech of recognition while presenting someone with an award or gift, the speaker should be thoughtful and sincere. The speech should be more than just a list of achievements and accomplishments. It should also acknowledge the person's character and personal qualities that make them deserving of the award or gift.

The speaker should also take the opportunity to express gratitude for the person's contributions and to thank them for their hard work and dedication. It is important for the speaker to connect with the audience and make the presentation engaging and memorable. The speech should be well-prepared and practiced to ensure that it is delivered confidently and smoothly. In summary, the speaker should deliver a heartfelt speech that recognizes the recipient's achievements and contributions, expresses gratitude, and connects with the audience.

To know more about speech visit:

https://brainly.com/question/32037809

#SPJ11

chris ofili created prince among thieves with flowers using ________ as his medium.

Answers

Chris ofili created prince among thieves with flowers using elephant dung as his medium.

Chris Ofili is a British artist known for his bold and colorful paintings that often feature intricate designs and unconventional materials. One of his most famous works is "Prince Among Thieves," a large-scale painting that depicts a figure with a crown made of flowers.

To create this piece, Ofili used a variety of materials as his medium, including acrylic paint, resin, glitter, and, most notably, elephant dung. He collected the dung during a trip to Zimbabwe, where he was inspired by the use of animal waste in traditional African art.

In "Prince Among Thieves," Ofili combines traditional and modern artistic techniques to create a vibrant and complex image. The flowers that make up the figure's crown are meticulously painted, while the background features bold, swirling patterns and shapes.

Overall, "Prince Among Thieves" is a stunning example of Ofili's unique style and creative vision. It demonstrates his willingness to push artistic boundaries and experiment with unconventional materials in order to create something truly extraordinary.

For more question on thieves visit:

https://brainly.com/question/31056642

#SPJ11

.Which of the following was not an influence on the development of art in the United States in the years following WWII?
A) A gradual erosion of traditional customs and conventions governing art production
B) The widespread immigration of European artists to America’s cultural centers
C) A prevailing culture of European optimism and economic prosperity
D) The threat of instant annihilation due to nuclear warfare

Answers

The answer is C) A prevailing culture of European optimism and economic prosperity. This choice was not a significant influence on the development of art in the United States in the years following WWII.

In the years following World War II, the art scene in the United States experienced various influences that shaped its development. A gradual erosion of traditional customs and conventions governing art production was one such influence. This shift allowed artists to explore new forms, styles, and techniques, breaking away from established norms. The widespread immigration of European artists to America's cultural centers was another significant influence. The influx of European artists brought diverse perspectives, techniques, and artistic movements, enriching the American art scene and leading to a cross-pollination of ideas.

The threat of instant annihilation due to nuclear warfare also played a crucial role in shaping post-WWII art. The fear and uncertainty associated with the Cold War and the nuclear arms race prompted artists to reflect on the human condition, social issues, and the impact of technology. It influenced artistic movements such as Abstract Expressionism and the development of art forms that expressed existential concerns and critiques of modern society. Overall, while European optimism and economic prosperity may have had some impact, it was not a prominent factor in shaping the art scene in the United States during that period.

To learn more about Abstract Expressionism click here: brainly.com/question/23331355

#SPJ11

True/False. at the end of the nineteenth century, many americans could play the piano and read music

Answers

The answer is True

Because it’s true

What architectural form makes up the Lion Gate at Mycenae?The gate represents a combination of Cyclopean construction and ashlar masonry. Cyclopean construction is a form of megalithic architecture, or building with very larg

Answers

The Lion Gate at Mycenae is a well-known example of ancient Greek architecture. This structure is made up of several different architectural forms that combine to create its unique appearance.

At the top of the gate is a triangular pediment, which is supported by two columns that stand on either side of the entrance. The columns are known as antae and are flanked by two large stone blocks that are called orthostats. The most distinctive feature of the Lion Gate, however, is the pair of massive stone lions that stand atop the lintel, or horizontal beam that spans the entrance. These lions are carved in high relief and are believed to represent the power and strength of the Mycenaean rulers. Together, these architectural forms create a monument that is both imposing and majestic, and that continues to inspire awe and admiration today.

To know more about Greek visit:

https://brainly.com/question/15236408

#SPJ11

ad placements based on editorial relevance, or the category of content is referred to as:

Answers

Ad placements based on editorial relevance, or the category of content is referred to as contextual advertising. Contextual advertising is an advertising approach that involves placing ads on websites or platforms that align with the content and context of the ad.

This type of advertising is based on the idea that the more relevant the ad is to the content, the more likely it is to capture the audience's attention and convert them into customers. For instance, if a user is reading an article about fitness and health, they are likely to be interested in ads related to exercise equipment or health supplements. Therefore, contextual advertising uses advanced algorithms to analyze the content of a webpage and match the ads to the context of the content. This strategy has proven to be very effective as it increases the engagement rates and ROI for advertisers.

To know more about algorithms  visit:

https://brainly.com/question/21172316

#SPJ11

The double bass in the classical orchestra, as in Mozart's Eine Kleine Nachtmusik, usually:plays only accents on stressed beatsdoubles the cello part an octave lowerhas a separate and distinct bass partdoubles the cello part in the same register

Answers

The double bass in the classical orchestra, as in Mozart's Eine Kleine Nachtmusik, often does Doubles the cello part an octave lower.

The correct option is D.

The double bass in the classical orchestra typically doubles the cello part in the same register, however, it can also have a separate and distinct bass part. This is particularly true in works by Wolfgang Amadeus Mozart, such as Eine Kleine Nachtmusik. In this piece, the double bass is used to add depth and contrast to the texture of the orchestra, creating a fuller, richer sound.

The double bass also adds a low-end foundation to the orchestra, allowing the other instruments to stand out more clearly. Additionally, the double bass can also be used to add accents on stressed beats, creating a more dynamic musical texture.

To know more about classical orchestra, click here:

https://brainly.com/question/31826104

#SPJ4

The Question-

The double bass in the classical orchestra, as in Mozart's Eine Kleine Nachtmusik, often does what?

Multiple Choice

A. Doubles the cello part in the same register

B. Plays only accents on stressed beats

C. Has a separate and distinct bass part

D. Doubles the cello part an octave lower

Other Questions
Circle the section on the dna template where the example primer would bind in the following sequence:3' ATTGCGCATTCCGATGGCTCGGAATAAGGCCGTCCTATTCAT 5'Example Primer: 5' ATTCCG 3' you are an it technician for your company. your boss has asked you to set up and configure the sick role is defined as? group of answer choices the pattern of expectations that define appropriate behavior for the sick and for those who take care of them the social sanctions faced by a person who claims to be sick for too long an illnesses that is questioned or considered questionable by some medical professionals the discriminatory practices used by corporations when an employee takes sick leave Array elements must be ________ before a binary search can be performed.A) summedB) set to zeroC) sortedD) positive numbersE) None of these where is a time-temperature indicator (tti) most commonly found? what is the most compacted form in which dna is found during interphase of the cell cycle? Answer choices A-y=3xB-y=4x-2C-y=-x+5F-y=x+3E-y=-2x-4F-y=x+3 at what level of output will average variable cost equal average total cost? when examining a client who has abdominal pain, a nurse should assess: a rate for a specific population subgroup (e.g. death rate for 4050 year olds) is referred to as 12 Select the correct answer. Which line from the text supports the inference that Juliet will pursue her interest in Romeo? . OB. OC. OD. Good pilgrim, you do wrong your hand too much. His name is Romeo, and a Montague, The only son of your great enemy. Come hither, Nurse. What is yond gentleman? Prodigious birth of love it is to me. That I must love a loathed enemy. Reset Next If the net present value is negative, it means that the return on the investment is:a. less than the discount rateb. more than the discount ratec. equal to the discount rated. acceptablee. it doesn't mean anything since the return on the investment bears no relationship to the discount rate. what is the role of the spermaceti in the sperm whale? How can droughts be triggered by: Human activities 2. hypothesis testing - setup: the american mathematical association claims that less than 60% of all americans like statistics. in a random sample of 80 americans, 55% of them liked mathematics. suppose you were to test the claim of the american mathematical society. Which of the following is given to a software interface with a system that allows code execution?A. Intentional Electromagnetic Interference (IEMI)B. National Institute of Standards and Technology (NIST)C. ProxyD. Command shell If global climate change causes rain and temperature patterns to shift dramatically in a region,A) plate tectonic action may dramatically change.B) ocean levels could suddenly drop.C) the region's biomes may shift to other types.D) the region's biodiversity may suddenly increase. Create x and y vectors from -5 to +5 with a spacing of 0.1. Use the meshgrid function to map x and y onto two new two-dimensional matrices called X and Y. Use your new matrices to calculate vector 2, with magnitude Z = sin x2 + y2 Title and label all axes. Include code and graphs. (a) Use the mesh plotting function to create a three-dimensional plot of Z. [5 Marks] (b) Use the surf plotting function to create a three-dimensional plot of Z. Compare the results you obtain with a single input (Z) with those obtained with inputs for all three dimensions (X, Y, Z). (5 Marks] (c) (d) Modify your surface plot with interpolated shading. Try using different colormaps. [2 marks] Generate a contour plot of Z. [3 Marks] Set up manually a colormap for parts (c) and (d), by determining the limits of the colorbar based on the plotted function and use a different colour for each range of values on the colorbar. (5 Marks] Generate a combination surface and contour plot of Z. (5 Marks) Solve for a. 24 = 6(3a - 5) a = [?] which of the following public goods would be the easiest for the government to make excludable? multiple choice city buses sewer systems police protection national defense