Which correctly lists the titles for this Venn diagram?

why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables. 50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat which is true about the subject matter of an ode?a. it is usually a well-known object such as a monumentb. it varies greatly from famous people to ordinary objectsc. it is often something imaginary or mythicald. it tends to focus on an explored exotic places Find the amount of sales tax if the sales tax rate is 5% and the cost of the winter coat is $40. Hint: this question is only asking for the sales tax. I dont get- this thing .-. b.10 ftC3 ftarea of the rectangle =area of the triangle = In "House of the Scorpion", why can't they harvest El Patron's body? (plz quickly help meh due tomorrow) Ill mark you a branilyst if you answer this question Two charged objects originally felt 12N of attraction. One charge is changed from to 3C to 6C and their distance changes from 15cm apart to 45cm apart. What is the new force of attraction ?