Which of the following are solutions to the equation |6x −1| = 17?
Select all that apply.

Which Of The Following Are Solutions To The Equation |6x 1| = 17?Select All That Apply.

Answers

Answer 1

Answer: 3,-3  

Step-by-step explanation:

|6x-1| = 17

For absolute value problems there is always two solutions. They will both be the same number, one positive and one negative.

6x-1 = 17

Add 1 to both sides.

6x-1 +1 = 17+1

6x=18

Now, divide by 6.

6x/6=18/6

x = 3

The two answers that would be correct are 3,-3.


Related Questions

The equation y = 1.5x describes a proportional relationship and is shown in the graph.

graph of a line beginning at point 0 comma 0 and going through 9 comma 6

Which of the following statements is true about the graph shown?

The graph is incorrect and the line should go through the point (6, 9).
The graph is incorrect and the line should go through the point (1.5, 1.5).
The graph does not show a proportional relationship.
The equation y = 1.5x is correctly represented by the graph.

PLEASE HELP, also its not B I got it wrong the first time

Answers

The source explains where you found the information that is in your graph. X-Axis  Bar graphs have an x-axis and a y-axis. Y-Axis

What is a graph simple definition?In math, a graph can be defined as a pictorial representation or a diagram that represents data or values in an organized manner. The points on the graph often represent the relationship between two or more things.Statistical Graphs (bar graph, pie graph, line graph, etc.)Exponential Graphs.Logarithmic Graphs.Trigonometric Graphs.Frequency Distribution Graph.Graph is defined as to create a diagram that shows a relationship between two or more things. An example of graph is to create a series of bars on graphing paper. YourDictionary. To put in the form of, or represent by, a graph. Webster's New World.The word "chart" is usually used as a catchall term for the graphical representation of data. "Graph" refers to a chart that specifically plots data along two dimensions, as shown in figure 1.

Given equation of the line,

If x = 0,

f(x)=-1.5+6

f(x)=-1.5(o)+6=6

Thus, the line intersects the y - axis at (0, 6)

If f(x) = 0,

o=-1.5+6= -1.5*=-6=x=4

Thus, the line intersects the x-axis at (4,0)

Plotting theses points in the given graph,

Then join them,

To learn more about graph refer to:

https://brainly.com/question/11619838

#SPJ1

Exactly 10% of the students in a school are left-handed. Select 15 students at random from the school and define W = the number who are left-handed.
a. yes
b. no
c. unsure

Answers

The statement is true , that the given sample follows binomial distribution.

If a random variable has two alternative outcomes (success or failure), it has a binomial distribution.

Each draw must be separate from the ones that came before it.

There is a set number of drawn components.

We randomly select 15 students, and since the sample size of 15 is less than 10% of the total population, we can assume that each draw is independent.

Because X has a binomial distribution, success is determined by whether the student is left-handed (failure is determined by whether the student is not left-handed).

The binomial distribution is the discrete probability distribution used in probability theory and statistics that only allows for success or failure as the possible outcomes of an experiment.

To learn more about binomial distribution

brainly.com/question/28108922

#SPJ4

Need help solving this. Please help

Answers

Answer:

Step-by-step explanation:

Reason 2: The box in the corner of the angle indicates that the angle is a right angle, which is 90 degrees.

Statement 3:

m<abd +m<dbc=m<abc

plase help me out tanks

Answers

Answer: x = 4

Step-by-step explanation:

5x - 3 ≥ 13

Substitute x with 4

5(4) - 3 ≥ 13

20 - 3 ≥ 13

17 ≥ 13

17 is greater than or equal to 13

4


You add 3 to each side
Cross 3 out
Divide 16/5
=4

Would greatly appreciate if any of you can answer the question in the attached image with full explanation including a strategy for solving it. Thanks in advance!

Answers

Answer:

B) a = - 3

------------------

Multiply both sides by ax - 2 to clear fractions:

24x² + 25x - 47 = (ax - 2)(- 8x - 3) - 5324x² + 25x - 47 = - 8ax² - 3ax + 16x + 6 - 5324x² + 25x - 47 = - 8a- (3a - 16)x - 47

Comparing both sides we can guess that -8a = 24 ⇒ a = - 3, then:

- (3*(-3) - 16) = - (- 9 - 16) = - (-25) = 25.

We see both coefficients match, hence a = - 3 is a right choice.

A data set includes data from student evaluations of courses. The summary statistics are n=85​, x=3.42​, s=0.56. Use a 0.05 significance level to test the claim that the population of student course evaluations has a mean equal to 3.50. Assume that a simple random sample has been selected. Identify the null and alternative​hypotheses, test​ statistic, P-value, and state the final conclusion that addresses the original claim.
What are the null and alternative​ hypotheses? A.) H0​: μ=3.50 H1​: μ>3.50 B.) H0​: μ≠3.50 H1​: μ=3.50 C.) H0​: μ=3.50 H1​: μ≠3.50 D.) H0​: μ=3.50 H1​: μ<3.50
Determine the test statistic= ____ ​(Round to two decimal places as​ needed.)
Determine the​ P-value = ____ ​(Round to three decimal places as​ needed.)
State the final conclusion that addresses the original claim. ▼ Fail to reject OR Reject H0. There is ▼ sufficient OR not sufficient evidence to conclude that the mean of the population of student course evaluations is equal to 3.50 ▼ is OR not is correct.

Answers

- The null hypothesis Is: [tex]$H_0: \mu=4.5$[/tex]

- The alternative hypothesis Is: [tex]$H_1: \mu \neq 4.50$[/tex]

- The test statistic is: t=-0.43

- The p-value of the test is of 0.6684.

What is p-value?

The p-value Is of 0.6684>0.05, which means that we can conclude that the population of student course evaluations has a mean equal to [tex]\mathbf{4 . 5 0}$.[/tex]

We are going to test If the mean Is equals to 4.50, thus, the null hypothesis Is:

[tex]H_0: \mu=4.5[/tex]

At the alternative hypothesis, we test If the mean Is different to 4.50, that is:

[tex]H_1: \mu \neq 4.50[/tex]

Since we have the standard devlation for the sample, the t-distribution is used. The value of the test statistic Is:

[tex]t=\frac{\pi-\mu}{\frac{\sqrt{n}}{\sqrt{n}}}$$[/tex]

For this problem:

[tex]$$\begin{aligned}& t=\frac{4.30-1.5}{\frac{2.21}{\sqrt[3]{80}}} \\& t=-0.43\end{aligned}$$[/tex]

We are testing If the mean is dlfferent from a value, thus, the p-value of test is found using a two-talled test, wlth t=-0.43 and [tex]$80-1=79 \mathrm{df}$[/tex].

Using a t-distribution calculator, the [tex]$\mathrm{p}$[/tex]-value is of [tex]$\mathbf{0 . 6 6 8 4}$[/tex].

The p-value is of 0.6684 > 0.05, which means that we can conclude that the population of student course evaluations has a mean equal to 4.50.

To learn more about hypothesis  visit:https://brainly.com/question/29519577

#SPJ4

The equation c = 13.99p represents the proportional relationship between the total cost (c) and the number of pounds (p) of shrimp at a grocery store. Which description is true, based on the equation of the proportional relationship?

Answers

each pound of shimp costs $13.99

Wyatt is deciding between two different movie streaming sites to subscribe to. Plan A costs $ 19 per month plus $0.50 per movie watched. Plan B costs $ 13 per month plus $1.50 per movie watched. Let A represent the monthly cost of Plan A if Wyatt watches x per month, and let B represent the monthly cost of Plan B if Wyatt watches x movies per month. Write an equation for each situation, in terms of x, and determine the number of monthly movies watched, x, that would make the two plans have an equal monthly cost.
A=
B=
Answer=

Answers

Equations representing the total costs for plan A and B are A = 19 + 0.50x and B = 13 + 1.5x, respectively, where x is the number of movies watches.

Cost of both the plans will be equal for 6 movies.

What is a linear equation?

A linear function is defined as a function that has either one or two variables without exponents.

Given that, Wyatt is deciding between two different film streaming sites to subscribe to, plan A costs $19 per month plus $0.50 per film watched, plan B costs $13 per month plus $1.50 per film watched.

According to question,

A = 19 + 0.50x and

B = 13 + 1.5x

For costs being equal, we have,

A = B

19 + 0.50x = 13 + 1.5x

x = 6

Hence, for 6 films the costs of both the plans will be equal and equation for both the plans are A = 19 + 0.50x and B = 13 + 1.5x

To know more about linear equation check the below link:

https://brainly.com/question/11897796

#SPJ4

these are easy questions for anyone who would like answer them just don’t put random answers

Answers

5. (-4-3n)*-8 = 32 + 24n.
6. 8(-b -4) = -8b - 32.
7. (1 - 7n) * 5 = 5 - 35n.
8. -6 * (x + 4) = -6x - 24.


The sum of two mixed fractions is 12 3/35
If one mixed fractions is 5 31/35 find the other mixed fraction.

Answers

let's convert the mixed fractions to improper fractions and then let's proceed.

[tex]\stackrel{mixed}{12\frac{3}{35}}\implies \cfrac{12\cdot 35+3}{35}\implies \stackrel{improper}{\cfrac{423}{35}} ~\hfill \stackrel{mixed}{5\frac{31}{35}}\implies \cfrac{5\cdot 35+31}{35}\implies \stackrel{improper}{\cfrac{206}{35}} \\\\[-0.35em] ~\dotfill[/tex]

[tex]12\frac{3}{35}~~ + ~~x~~ = ~~5\frac{31}{35}\implies \cfrac{423}{35}+x=\cfrac{206}{35}\implies \stackrel{\textit{multiplying both sides by }\stackrel{LCD}{35}}{35\left( \cfrac{423}{35}+x \right)=35\left( \cfrac{206}{35} \right)} \\\\\\ 423+35x=206\implies 35x=-217 \\\\\\ x=\cfrac{-217}{35}\implies x=\cfrac{-31}{5}\implies {\Large \begin{array}{llll} x=- 6\frac{1}{5} \end{array}}[/tex]

to convert an improper fraction like -31/5 to a mixed fraction, well, first off, we nevermind the sign, so we only use 31/5 and then we divide 31 ÷ 5.

hmm 31 ÷ 5 gives us a quotient of 6, and a remainder of 1, we put the quotient upfront and the remainder as the numerator, with the old denominator and sign back in.

I am not sure how to do it sorry I wish I could help you

Use the product property to rewrite log2 256b

Answers

The solution for the given logarithmic expression would be x = 8.

What are the logarithms?

In mathematics, the logarithm is the inverse function of exponentiation. That means the logarithm of a number x to the base b is the exponent to which b must be raised, to produce x.

Given:

  [tex]log_2(256)[/tex]

Let

            [tex]x=log_2(256)[/tex]

By using the property of logarithms we can write

          [tex]2^x=256\\\\2^x=2^8\\[/tex]

Since the bases are the same, the two expressions are only equal if the exponents are also equal.

      x = 8.

Hence, the solution for the given logarithmic expression would be x = 8.

To learn more about logarithms, visit:

https://brainly.com/question/25710806

#SPJ1

Give the equation of each quadratic in the form, picture of formula and graphs attached.

Answers

The equation of each quadratic in the picture of formula and graphs attached is y=-1(x+8)^2 +9 and y=1/4*(x-6)^2 +3

What is Graph Transformation?

When a graph is transformed, the graph's curve either "moves to the left/right/up/down," "expands or compresses," or "reflects." For instance, by simply pushing the graph of the function g(x) = x2 up by 3 units, the graph of the function f(x) = x2 + 3 is generated. graph transformations are highly useful for graphing functions without having to start from scratch since they allow you to move, extend, compress, or reflect the curve. The graph of the parent function is either "moved," "resized," or "reflected" by a graph transformation. The three primary categories of graph transformations are as follows:

Translation DilationReflection

A)

first of all we need to find which type of parabolic graph is it

from the picture give we can clearly see it is a x^2=-4ay type of graph

and using graph transformation formula

i.e. y= a(x-h)^2 + k

where h = -8

k=9

we get y=a(x+8)^2+9

as we know (-5,0) lie on this graph

so,

0=a(-5+8)^2+9

a=-1

so the equation is y=-1(x+8)^2 +9

B)

first of all we need to find which type of parabolic graph is it

from the picture give we can clearly see it is a x^2=-4ay type of graph

and using graph transformation formula

i.e. y= a(x-h)^2 + k

where h = 6

k=3

we get y=a(x-6)^2+3

as we know (0,12) lie on this graph

so,

12=a(0-6)^2+3

a=1/4

so the equation is y=1/4*(x-6)^2 +3

Learn more about Graph transformation from the link below

https://brainly.com/question/10059147

#SPJ1

Help i need help with this question.

Answers

Based on the SAS, SSS, and the transitive property of congruence, the reason why ΔABC ≅ ΔGHJ is because of option B.

What is SAS and SSS?

The SAS is a triangle theorem that states that two triangles are congruent if they both have two pairs of congruent sides and a pair of included congruent angles.

On the other hand, the SSS states that two triangles that have three pairs of congruent sides are equal.

What is the Transitive Property of Congruence?

The transitive property of congruence states that if two triangles are congruent to a third triangle, then all three triangles are congruent to each other.

Based on the SSS, triangle ABC is congruent to triangle DEF.

Based on the SAS, triangle DEF is congruent to GHJ.

Therefore, based on the transitive property of congruence, triangle ABC is congruent to triangle GHJ.

Therefore, the reason why ΔABC ≅ ΔGHJ is because of the reason given in option B.

Learn more about the SAS and SSS on:

https://brainly.com/question/3999145

#SPJ1

What is the correct to this answer ??? ( answers only)

Answers

Answer:

k is greater or equal to -5

Step-by-step explanation:

[tex] - 5 \leqslant k[/tex]

here, -5 is on the left side of the inequality sign which means it is less than or equal to k.

JK is a midsegment of FGH. Find the values of x and y.​

Answers

JK is a midsegment of triangle FGH. Hence, the values of x and y are 18 and 14 respectively.

What is a midsegment of a triangle?

A triangle's midsegment is a line segment that connects the midpoints or centers of two of its opposite or adjacent sides.

Given that, JK is a midsegment of triangle FGH.

Also the values of:

FG = 28

FJ = x

JH = 10

JK = y

As, JK is midsegment of FG, we have:

JK = FG / 2

y = 28 / 2

y = 14

So, the value of y could be 14.

Also, FG = 28

FJ + JH = FG

10+x = 28

x = 28 - 10

x = 18

So, the value of x could be 18.

Hence, the values of x and y are 18 and 14 respectively.

Learn more about triangles here:

https://brainly.com/question/2773823

#SPJ1

Answer:

x=10

Y=14

Step-by-step explanation:

big ideas

Rewrite the expression in terms of the given function. (sec x - csc x) / (1 - tan x) in terms of sin x (sec x - csc x) / (1-tan x) =

Answers

The trigonometric expression (sec x - csc x) / (1 - tan x) is equivalent by trigonometric formulas and algebra properties to - sin x.

How to rewrite a trigonometric expression in terms of sine function

Herein we find a trigonometric expression that must be rewritten in terms of sin x by means of trigonometric formulas and algebra properties. The original expression is shown below:

(sec x - csc x) / (1 - tan x)

First, the original expression is written:

(sec x - csc x) / (1 - tan x)

Second, use the definitions of secant, cosecant and tangent:

[(1 / cos x) - (1 / sin x)] / [1 - (sin x / cos x)]

Third, use algebraic properties to simplify the expression:

[(sin x - cos x) / (sin x · cos x)] / [(cos x - sin x) / cos x]

[(sin x - cos x) · cos x] / [sin x · cos x · (cos x - sin x)]

- sin x

To learn more on trigonometric expressions: https://brainly.com/question/22624805

#SPJ1

the number k if 3/11 (fraction) of k is 12

Answers

Answer:

k = 44

Step-by-step explanation:

[tex]\frac{3}{4}[/tex]k = 12  Multiple both sides by [tex]\frac{4}{3}[/tex]

k = 44

Answer:

k = 44

Explanation:

You can write this into an equation, where k x 3/11 = 12. If you multiply both sides of the equation by 11 and divide by 3, you get k by itself.

k x 3/11 = 12

3k/11 = 12

3k = 132

k = 44

In a food cocktail,the ratio of orange juice to apple juice to coconut milk is 3:2:4, respectively. How much of each do I need to take if I have 5 more oz of orange juice than apple juice

Answers

By ratios ,orange = 15 , apple = 10 , coconut = 20 are needed to make 45 liters of this cocktail.

What does the math ratio mean?

When b does not equal 0, an ordered pair of numbers a and b, represented as a / b, is said to be a ratio. A proportion is an equation that sets two ratios at the same value.

                   As an illustration, you could express the ratio as 1: 3 if there is 1 guy and 3 girls (for every one boy there are 3 girls)

orange = 3

apple = 2

coconut = 4

total = 9

orange =  3/9  * 45  = 15

 apple = 2/9  *  45  = 10

coconut = 4/9  * 45  = 20

Learn more about Ratio

brainly.com/question/13419413

#SPJ1

The complete question is -

In a fruit cocktail, the ratio of orange juice to apple juice to coconut milk is 3:2:4, respectively. How much of each type is needed to make 45 liters of this cocktail?

Simplify by reducing. Begin by determining the domain restrictions. Show all work.

x2 + 6x + 9 over x2 - 9

x2+6x+9/x2-9

3x2 - 9x over x2 - x - 6

3x2-9x/x2-x-6

Answers

Using simplification by factorisation and division

(x² + 6x + 9)/(x² - 9) = (x + 3)/(x - 3) and (3x² - 9)/(x² - x - 6) = 3x/(x + 2)

How to simplify the equations by factorization

To simplify the equations, we shall factorize both the numerator and the denominator, and divide through by a common factor.

for the equation (x² + 6x + 9)/(x² - 9);

the numerator:

x² + 6x + 9 = x² + 3x + 3x + 9

x² + 6x + 9 = x(x + 3) +3(x + 3)

x² + 6x + 9 = (x + 3)(x + 3)

the denominator:

x² - 9 = x² - 3²

x² - 9 = (x + 3)(x - 3) {difference of two squares}

(x² + 6x + 9)/(x² - 9) = (x + 3)(x + 3)/(x + 3)(x - 3)

divide through by the common factor (x + 3)

(x² + 6x + 9)/(x² - 9) = (x + 3)/(x - 3)

For the equation; (3x² - 9)/(x² - x - 6)

the numerator:

3x² - 9 = 3x(x -3)

the denominator:

x² - x - 6 = x² -3x + 2x - 6

x² - x - 6 = x(x - 3) + 2(x - 3)

x² - x - 6 = (x + 2)(x - 3)

divide through by the common factor (x - 3)

(3x² - 9)/(x² - x - 6) = 3x/(x + 2)

Thus, (x + 3)/(x - 3) and 3x/(x + 2) are the results for simplifying (x² + 6x + 9)/(x² - 9) and (3x² - 9)/(x² - x - 6) respectively using factorization.

Learn more about factorization here:https://brainly.com/question/25829061

#SPJ1

Which expression is equivalent to 225/625m⁴n⁶

A. 1/20m²|n³|
B. 1/20m²n⁴
C. 3/5m²|n³|
D. 3/5m²n⁴​

Answers

The equivalent expression of 225/625m⁴n⁶ is 3/5m²n³.

What is the square root?

A number y such that y = x², or a number y whose square is x, is referred to as the square root of a number x in mathematics. For instance, since 4² = 2 = 16, 4 and -4 are the square roots of 16.

We have,

225/625m⁴n⁶

So, simplifying the given equation,

= 225/625m⁴n⁶

dividing the numerator and denominator by 25 we get,

= 9/25m⁴n⁶

again by taking the square root of the numerator and denominator we get,

= 3/5m²n³.

Hence, the equivalent expression of 225/625m⁴n⁶ is 3/5m²n³.

To learn more about the square root visit,

https://brainly.com/question/428672

#SPJ1

How many degrees do the angles of a triangle contain?

Answers

Answer: 180

Step-by-step explanation:

all 3 angles equal 180 degrees if you divide by 3 each angle will be 60 degrees

Dos cuadrados de lado 10 cm se sobreponen formando un rectángulo de 17 cm de largo, como se muestra en la figura. ¿Cuál es el área de la franja amarilla en centímetros cuadrados?

Answers

The area of the rectangular yellow region is of:

30 cm².

How to obtain the area of a rectangle?

The area of a rectangle of base b and height h is obtained as the multiplication of these dimensions, as follows:

Area = base x height.

From the image given at the end of the answer, these dimensions are given as follows:

Height = 10 cm, which is the side length of the square.Base = 3 cm, as the two squares would combine for a side length of 20 cm, but they combine for 17 cm, hence 20 - 17 = 3 cm.

Then the area of the yellow region is calculated as follows:

Area = 10 x 3 = 30 cm².

Translation

The problem asks to obtain the area of the rectangular region, considering that:

The squares have side length of 10.The combined squared combine for a side length of 17.

Missing Information

The region is given by the image shown at the end of the answer.

More can be learned about the area of a rectangle at https://brainly.com/question/25292087

#SPJ1

4.4 times 2.727 km Answer with explanation

Answers

Answer:

12 km

Step-by-step explanation:

4.4 * 2.727 km = 11.9988   ( using a calculator)

              since the smallest factor (4.4)  has only 2 significant digits , your answer should be rounded to only 2 S.D.      so   = 12 km

100 points. Which is the graph of f (x) x - 1/ x2 - x 6

Answers

Answer:

  A – see below

Step-by-step explanation:

You want to identify the graph of f(x) = (x -1)/(x² -x -6).

Factored form

The function can be factored as ...

  [tex]f(x) = \dfrac{x-1}{(x-3)(x+2)}[/tex]

The numerator is zero when x=1, so that is where the x-intercept lies.

The denominator is zero for x=-2 and x=3, so those are the locations of the vertical asymptotes.

The graph that has vertical asymptotes at x=-2 and x=3, and an x-intercept of x=1 is Graph A.

<95141404393>

The median weekly gross income for someone with a bachelor's degree was $2,117.00. If they continued their education and training and earned a master's degree, they had an increase in their median weekly income of about 46.1%. Determine the median weekly income for someone with a master's degree.
$2,856.12
$3,092.94
$3,153.76
$2,908.45

Answers

A master's degree earner's typical weekly salary is $3,092.94.

What is the meaning of percentage?

A percentage in mathematics is a number or ratio that may be stated as a fraction of 100.In determining a percentage of a number, we should first divide it by 100 before multiply the outcome by 100. As a result, the proportion refers to a part per 100. The word "percent" refers to a fraction of one hundred. The letter "%" stands for it.

Considering that the median gross weekly wage for a bachelor's degree holder was $2,117.00.

If any one had mater degree, then an increase in the median weekly income of about 46.1%.

To find the increment multiply $2,117.00 with increase rate:

The increment is $2,117.00 × 46.1% = 2,117.00 × 46.1/100= $975.937

The total the median weekly income is

$975.937 + $2,117.00

= $3,092.937

≈ $3,092.94

To learn more about percentage. click on below link:

https://brainly.com/question/21092536

#SPJ1

Whats the simplified version of √(√21-2√3)^2

Answers

The required simplified solution of the given expression is given as √3(√7 - 2).

Given that,
To determine the simplified solution of the √(√21-2√3)²

What is simplification?

The process in mathematics to operate and interpret the function to make the function or expression simple or more understandable is called simplifying and the process is called simplification.

here,
= √(√21-2√3)²
=√21-2√3       (√a² = a)
= √3(√7 - 2)

Thus, the required simplified solution of the given expression is given as √3(√7 - 2).

Learn more about simplification here:

https://brainly.com/question/12501526

#SPJ1

Using the methods provided in the text for computing confidence intervals for population proportions, a marketing analyst takes a survey of 1000 randomly selected consumers. She asks if they prefer low-sodium soup products. Using the results, she provides a 95% confidence interval for the population proportion of consumers who prefer low-sodium soup products. The interval has a margin of error of 03. Which of the following is an appropriate interpretation of these results? (a) The sample proportion from the survey differs from the population proportion by at most 03. (b) 95% of all possible values of the population proportion are contained in the interval provided. (c) The analyst is 95% confident that all possible values for the sample proportion from a sample of 1000 consumers are in the interval provided. (d) Using these methods, 95% of all possible confidence intervals from a sample of 1000 consumers will contain the population proportion. (e) The reported confidence interval will contain the population proportion 95% of the time.

Answers

The reported confidence interval will contain the population proportion of consumers 95% of the time.

In statistics, a confidence interval describes the likelihood that a population parameter would fall between a set of values for a given percentage of the time. Confidence ranges that include 95% or 99% of anticipated observations are frequently used by analysts. Therefore, it can be concluded that there is a 95% probability that the true value falls within that range if a point estimate of 10.00 is produced using a statistical model with a 95% confidence interval of 9.50 - 10.50.

To know more about confidence intervals visit: brainly.com/question/24131141

#SPJ4

Please can anyone answer this percentage question cor grade 7

Answers

well, we know it was 480, then we reduce it by 50.

a)

if we take 480 to be the 100%, what's 50 off of it in percentage?

[tex]\begin{array}{ccll} amount&\%\\ \cline{1-2} 480 & 100\\ 50& x \end{array} \implies \cfrac{480}{50}~~=~~\cfrac{100}{x} \\\\\\ \cfrac{ 48 }{ 5 } ~~=~~ \cfrac{ 100 }{ x }\implies 48x=500\implies x=\cfrac{500}{48}\implies x=\cfrac{125}{12}\implies \boxed{x\approx 10.4}[/tex]

now, the TV is only 480 - 50 = 430, then it gets reduced another 50.

if we take 430 to be the 100%, what's 50 off of it in percentage?

[tex]\begin{array}{ccll} amount&\%\\ \cline{1-2} 430 & 100\\ 50& y \end{array} \implies \cfrac{430}{50}~~=~~\cfrac{100}{y} \\\\\\ \cfrac{ 43 }{ 5 } ~~=~~ \cfrac{ 100 }{ y }\implies 43y=500\implies y=\cfrac{500}{43}\implies \boxed{y\approx 11.6}[/tex]

b)

hmmm the absolute change of the reductions?   that sounds like 480 - 50 - 50 = 380.

c)

well, the overall percentage hmmm well, that's the $100 reduction total.

if we take $480 as the 100%, what's $100 off of it in percentage?

[tex]\begin{array}{ccll} amount&\%\\ \cline{1-2} 480 & 100\\ 100& z \end{array} \implies \cfrac{480}{100}~~=~~\cfrac{100}{z} \\\\\\ \cfrac{ 24 }{ 5 } ~~=~~ \cfrac{ 100 }{ z }\implies 24z=500\implies z=\cfrac{500}{24}\implies z=\cfrac{125}{6}\implies \boxed{z\approx 20.8}[/tex]

I need help with my math homework

Answers

Answer:

1. 2

2. 7

3. 15

4. 80

5. 70

Step-by-step explanation:

Answer:

1st question's answer is 2 x 90 = 180

2nd question's answer is 70 x 7 =490

3rd question's answer is 240 = 4 x 60

4th question's answer is 9 x 80 = 720

5th question's answer is 70 x 8 =560

Solve the system below by substitution
6x-y=-23
2x+5y=-13

Answers

Answer:

x= -4 y= -1

6x - y = - 23

-y=-23-6x

y=6x+23, use this to plug in for y in the second equation.

2x + 5y = -13

2x + 5(6x+23) = -13

2x+30x+115=-13

x= -4, use this to plug in for x in the first equation.

6x - y = - 23

6(-4)-y=-23

-24-y=-23

-y=-23+24

-y=1

y= -1

Step-by-step explanation: not doing this to steal points

Answer:

here is your solution.

Step-by-step explanation:

x=4 & y=1

Other Questions
Below is a list of inventions that came out during the Industrial Revolution, describe the impactof each oneIndoor plumbingToiletsToilet paper Electricity Cars Trains Radio Steam Engine Dynamite Cameras I have a triangle with c as hypotenuse, b as opposite, and nothing for adjacent. Bottom left corner is 62 degrees and the right bottom corner is 90 degrees. Round answer to nearest 16th of an inch SolvingThe product of 5 and the differencebetween a number and 7 is 75. What isthe number? a pregnant woman in the second trimester of pregnancy complains of constipation and describes the home care measures she is taking to relieve the problem. which would the nurse determine is a harmful measure in preventing constipation? Which statement accurately describes how toproperly use a semicolon to join independentclauses? An advantage of the balanced scorecard framework is the ability to automate the flow of information on __________, so that executives are kept fully informed about business performance. original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge. Please help me solve! a dam holds back the water in a lake. if the dam has a small hole 1.4 meters below the surface of the lake, at what speed does water exit the hole? A corporation has the following account balances: Common Stock, $1 par value, $80,000; Paid-in Capital in Excess of Par Value, $2,700,000. Based on this information, the a. legal capital is $2,780,000.b. number of shares issued is 80,000.c. number of shares outstanding is 2,780,000.d. average price per share issued is $3.48. 4. Using the statistics in the following report generated for Community Hospital, calculate (round to two decimal places) the percentage of occupancy for the month of December. Remember to calculate the Total for Patient Care Units (IPSD, Bed Count and Percent of Occupancy). There are some coloured pins in a bag. The pins can be green,yellow, purple, or grey. A pin is going to be taken at random from the bag. The table shows the probabilities of picking a purple or grey pin. The probability of picking a green pin is three times the probability of picking a yellow one. a)Complete the table. There are 14 purple pins in the bag. b)Work out how many green pins are in the bag hormones in the body are not responsible for regulatingA) development B) Growth C) OxygenD) Reproduction Can you see or hear radio waves?A) You can't hear radio waves but you can see them.B) You can see and hear radio waves.C) You can't see radio waves but you can hear them.D) You can neither see nor hear radio waves.D For the following data set, calculate the percentage of data points that fall within one standard deviation of the mean and compare the result to the expected percentage of a normal distribution.{8, 12, 27, 32, 45, 57, 61, 73, 82, 94} Literal Equations help asap !! Which statement best evaluates this response to the writing prompt?Prompt:Write an essay for your history teacher. In this essay, Identify what you believe is the most important reason the American Revolutionary War was fought. Support your claim with reasons and evidence.-Associated Passage:The revolutionary War period was a dark and difficult time for the United States. The war was violent. It was expensive. Independence was never certain. Still, I believe it was the right decision to fight it.A. It is weak because it does not discuss the reasons for war B. It Is strong because it suggests its position rather than stating it directly C. It Is strong because the author uses his or her personal voice D. It Is weak because its language is not appropriate for a teacher when assessing a client, what finding would the nurse interpret as indicating stimulation of the parasympathetic nervous system? (select all that apply.) How did the role of the Interstate Commerce Commission change by 1920?