Which of the following correctly demonstrates a verb tense shift?

Group of answer choices

While I had been running in the park, a bird flying into my face.

While I run in the park, a bird fly into my face.

While I was running in the park, a bird flying into my face.

While running in the park, a bird flew into my face.

Answers

Answer 1

Answer:

While I run in the park, a bird fly into my face.

Explanation:

It changes time in the same sentence so that is the "time shift"


Related Questions

Explain why the Thunderhead was not given full control over death? .
In scythe

Answers

The Thunderhead was their form of government, and the scythes needed morals to choose who lives and dies. It made the job harder and as fair as it could be.

Which is the meaning of the word languidly as it appears in the following sentence from the passage?
A flock of gulls lying on the short grass near the lake rose up languidly, drifting like blown snowflakes over the
rim of the cliff.
full of care
O without sound
O in a lazy manner
O in a graceful way

Answers

Answer:

in a lazy manner

Explanation:

From the passage, it is described that a flock of gulls lying on a short grass, "..rose up languidly..."

The meaning of the word "languidly" as used in the sentence from the passage is "in a lazy manner".

This is because, languid means to move about in a disinterested manner and the gulls rose up lazily.

15. What is this encyclopedia entry mainly about?
While Neil Armstrong may forever have the distinction of being the first man to walk on the moon, he wasn't the first man to walk in space. In fact, the first person to walk in space wasn't American. That distinction belongs to Russian Alexei Leonov. He flew into space in 1965 boarding the Voskhod 2 spacecraft. Like Armstrong, Leonov also had a partner to share in this accomplishment as Leonov was joined by cosmonaut Pavel Belyayev. Leonov exited the Voskhod's hatch and took the first steps into space. He wore a backpack containing air, similar to the pack worn by scuba divers. His 12-minute walk was the first of its kind. The fact that the walk looked more like he floated did not take away from this accomplishment. Three months later, the U.S. played catch-up and sent astronaut Edward White aboard the Gemini to walk in space.
15. What is this encyclopedia entry mainly about?

a. Alexei Leonov graduated from the Soviet air force flying and engineering schools.
b. During the 1960s, the American space program tried to catch up to the Russians.
c. American Edward White was the second human to walk in space in 1965.
d. Russian Alexei Leonov was the first human to walk in space in 1965.

Answers

Answer: D

Explanation:

I just went to florida and didn’t get The virus

Answers

Answer:

Good for you but I wouldn't have risked it

in the diary of anne frank what does anne say she does and does not want from people?

Answers

Answer She doesn’t want hatred but she want love and kindness

Explanation:

I don’t know if anyone knows this.

What is the tone and mood of the 2 sentences.
(I highlighted them)

Answers

Answer:

Tone is serious and mood is dark

Explanation:

good mornin'!!!!
This is a summer puzzle but its still winter
find 8 summer words and receive 20 points !!
best of luck!!

Answers

Answer:

5 down it goes across the word "Summer" Have a good day!

Explanation:

Answer:

Camp

Water

Swim

Summer

Hot

Explanation:

This is what I saw so far

Research into the thermite reaction (displacement reaction) used in the welding of rail tracks. Write out the equation and identify where REDuction and OXidation occur. You should also be able to explain why this reaction is suitable for joining train tracks together.

Answers

Answer:

See explanation

Explanation:

The thermite reaction is a redox reaction that is very important in metallurgy. The reaction is as follows;

2 Al(s) + Fe2O3(s) --> 2Fe (s) + Al2O3 (s).

In this reaction, aluminium is oxidized from 0 to +3 oxidation state while iron is reduced from +3 to zero oxidation state from left to right respectively as shown in the reaction equation above.

This reaction occurs at high temperature and as a result of this, it can be used to join metals at such high temperature. This is why the reaction can be used to join rail tracks.

Dear Ty,

help plz, My dad got the pictures that we took on the trip to Alaska. I promised you that I would send you some. I'm sending them with this letter. The one of you and me on the boat is especially good. I'm still thinking about all the fun things that we did. The train ride was the best. It was fun eating breakfast on the train. I'm glad we got to see the mother bear and her cubs. I hope you have a good year at school.

Your friend,




Which detail best belongs in the letter?
A.
We have decided to adopt a new pet.
B.
My mom said I could play baseball this year.
C.
The pictures turned out really well.
D.
Alan came over to my house for a sleepover.

Answers

Answer:

c the picture turned out well

Explanation:


Healthy citizens are the greatest asset of
country. what can a state do to keep her citizens healthy,? explain

Answers

There is a lot of room for interpretation here. Without many guidelines this question can do so many ways so I will do my best to answer.

A state can make sure it’s citizens are healthy with a ready supply of medical supplies. Without the supplies the medical field would be undersupplied and unable to accurately or quickly complete its job.

Readily available healthcare is also important for healthy citizens. If your citizens can’t afford treatment or can’t safely afford treatment they will opt to not have it, therefore remain unhealthy for longer. A healthy economy also plays into this so the citizens can afford the healthcare and treatments.

Legislation on requiring “sick days” at work would allow for more healthy citizens as well. If a worker is sick but still has to attend work, so they can live, they will likely infect others. That would only increase the amount of sick people though.

Education on sickness and how it affects yourself and others. Those who are educated are less likely to put others in danger, especially in reference to preventable sicknesses.

All of those options, and many more as it is a broad topic, can allow a state to control the amount of unhealthy citizens. If citizens can afford to, and are educated enough to, stay healthy they will.

Which of the following are the primary types of evidence one may use to support a claim or thesls?
Select all that apply.
opinion
O empirical
O logical
O anecdotal
O legal

Answers

Answer:

I think it is C.

Explanation:

Hope this helped have an amazing day!

You are loved. You are beautiful. You are amazing.

Life is funny. Things change, people change, but you will always be you, so stay true to yourself and never sacrifice who you are for anyone. -Zayn Malik

Answers

Answer:

Wow very heartfull

Explanation:

what two elements define a story's setting​

Answers

Geographical Location

Weather Conditions

Question 8
1 pts
What is the allegorical / symbolic meaning of the "cross" the poet "wear[s] upon his
breast"?
O he has visited Colorado to ease his feelings of loss
O he regrets that he was angry "cross" with his wife
O he has worn a cross since the day his wife died
O he feels grief that does not disappear

Answers

you would need to submit the actual poem as well, for reference

can someone help me on a explanation on number 5. herd behavior common lit?

Answers

Answer:

Herd behavior suggests that there are limits to human beings' free will. The actions of a large group can greatly influence an individual's decisions... Have you heard of races,

R Restate

A Answer

C Cite from the text

E Explain

S Summarize

Also “Herd behavior” is a term used to describe the tendency of individuals to think and act as a group. As you read, take notes on the causes of herd behavior. behavior of animals in herds, particularly when they are in a dangerous situation such as escaping a predator.

And Herd behavior occurs in animals in herds, packs, bird flocks, fish schools and so on, as well as in humans. ... Demonstrations, riots, general strikes, sporting events, religious gatherings, everyday decision-making, judgement and opinion-forming, are all forms of human based herd behavior.

I hope this help even though its not totally the answer it will help you....

Explanation:

1.How do family structures influence the personal development of an adolescent?
2. Explain how heredity and environment influence personal development (10pts)​

Answers

Similarly, adolescents who report that they have a good relationship with at least one parent are more likely to report good physical and mental health. Family arguments during adolescence are to be expected, and may even serve an important developmental purpose.

Nations strength poem

Answers

Answer:

Explanation:

This poem reflects that patriotism is not found on the nationalistic attitude of all wealth,weapons ,and powerful leaders.

Which is a correctly punctuated COMPOUND sentence?
The qirl ran acroSs the street and qot the mail.
B)
The girl ran across the street, and she got the mail.
The girl ran across the street because she wanted to get the mail.
D)
The qirl ran across the street, got the mail, and returned to the house.

Answers

Answer:

D). The girl ran across the street, got the mail, and returned to the house.

Explanation:

A compound sentence is a sentence that contains at least two independent clauses that is joined by a comma or coordinating conjunction.

Therefore, the correctly punctuated COMPOUND sentence is option D.

How does the author support the fact that using LEDs can help save power consumption?

A.by using first-hand accounts of people

B. by providing data from reliable sources

C.by stating only personal opinions

D. by including a personal experience

Answers

Answer:

b

Explanation:bc ik t

Answer:

b

Explanation:

i got it wrong from the other person

How does this passage demonstrate the use of propaganda? It uses bandwagon by claiming that Snowball was fighting alongside Jones. It uses scapegoating by blaming Snowball for actions he is not responsible for. It uses hyperbole by exaggerating Snowball’s actions during the Battle of the Cowshed. It uses repetition by repeating tales of Snowball’s actions during the Battle of the Cowshed.

Answers

This question is missing the passage. I've found the complete question online. It is the following:

Read the passage from Animal Farm.

In April, Animal Farm was proclaimed a Republic, and it became necessary to elect a President. There was only one candidate, Napoleon, who was elected unanimously. On the same day it was given out that fresh documents had been discovered which revealed further details about Snowball's complicity with Jones. It now appeared that Snowball had not, as the animals had previously imagined, merely attempted to lose the Battle of the Cowshed by means of a stratagem, but had been openly fighting on Jones's side. In fact, it was he who had actually been the leader of the human forces, and had charged into battle with the words "Long live Humanity!" on his lips. The wounds on Snowball's back, which a few of the animals still remembered to have seen, had been inflicted by Napoleon's teeth.

How does this passage demonstrate the use of propaganda?

A. It uses bandwagon by claiming that Snowball was fighting alongside Jones.

B. It uses scapegoating by blaming Snowball for actions he is not responsible for.

C. It uses hyperbole by exaggerating Snowball’s actions during the Battle of the Cowshed.

D. It uses repetition by repeating tales of Snowball’s actions during the Battle of the Cowshed.

Answer:

The passage demonstrates the use of propaganda because:

B. It uses scapegoating by blaming Snowball for actions he is not responsible for.

Explanation:

Scapegoating is a propaganda technique used to relieve someone from guilt or responsibility by blaming someone else. It distracts people's attention to the one being blamed, preventing them from focusing on the problem itself and the fact that it needs to be fixed.

The passage we are analyzing here is an example of scapegoating. It was taken from the allegorical novella "Animal Farm", by George Orwell, in which the animals are used to represent the leaders and the people of Russia after the revolutions that led to the Soviet regime.

Napoleon, one of the pigs, has become a dictator on the farm. To divert the animals' attention from the atrocities he is committing, he blames Snowball, a pig who no longer lives at the farm. In reality, Snowball was the one pig who truly worked to benefit all the animals. Napoleon kicked him out of the farm in order to obtain power for himself. Now, he uses Snowball as a scapegoat, blaming him for things he has never done. By doing that, Napoleon controls, confuses, and scares the other animals.

Answer:

B. It uses scapegoating by blaming Snowball for actions he is not responsible for.

Read the following sentences that contain Midwestern sayings.

You take the first left after the school, and then turn right at the first intersection that has a stop–and–go light.

What is the meaning of stop–and–go light as it is used in the sentence?
A landmark

B stop sign

C traffic light

D train crossing

Answers

i’m pretty sure it’s C, that’s what my friends call traffic lights a lot
:)
The answer is C. The term stop and go refers to how the stop light tells you weather to stop or go

What does narrative context mean?

Answers

Answer:

Context is the background, environment, setting, framework, or surroundings of events or occurrences. Simply, context means circumstances forming a background of an event, idea or statement, in such a way as to enable readers to understand the narrative or a literary piece.

Explanation:

Answer:

is that narrative is the systematic recitation of an event or series of events while context is the surroundings, circumstances, environment, background or settings that determine, specify, or clarify the meaning of an event or other occurrence. As a verb context is. (obsolete) to knit or bind together; to unite closely. narrative. English. Simply, context means circumstances forming a background of an event, idea or statement, in such a way as to enable readers to understand the narrative or a literary piece. It is necessary in writing to provide information, new concepts, and words to develop thoughts.

Explanation:

the vegetables that people leave uneaten are often the most nutritious punctuate the following sentence.​

Answers

Answer:

The vegetables that people leave uneaten are often the most nutritious.

Explanation:

I think

Answer:

yep he's right

Explanation:

s' just a period

The following question is based on your reading of “Robinson Crusoe" by Daniel Defoe.
By the time Crusoe and Friday finish making the canoe, how long has Crusoe been on the island?
a. 2 years
C.
b. 10 years
d. 26 years
18 years

Answers

Answer:

i dont see which answers are which so, i got 6 years

Explanation:

can u help me please

Answers

Answer:

b

Explanation:

70% chance its b 20% its c 7% its a 3% its d

where is the heart located

Answers

Answer:

the heart is in the front and middle of your cheats

Answer:

Up the as.s throught the small intensity to the large into the kidney up in your stomach, up the esophagus take a huge left to your left lung and down your air tubes through some blood veins and theres your heart :)

Part 1- Write three of each of the following types of questions about school issues or someother issue that you have seen in the news:

3 yes/no questions

3 leading or biased questions

3 open-ended questions

Part 2:

Write 10 open-ended (unbiased) about school issues that you might ask a student or staff member about.

Answers

Answer:

is a jet a plane

is a cat a dog

is

Which measurements represent the side lengths of a right triangle?

9 in, 12 in, 15 in
9 in, 12 in, 15 in

2 in, 7 in, 9 in
2 in, 7 in, 9 in

10 in, 12 in, 20 in
10 in, 12 in, 20 in

3 in, 4 in, 8 in

Answers

Answer:

stay happy

Explanation:

WILL MARK YOU BRAINLIEST!!!!! 35 POINTS

Daily communication is an essential part of our lives. Nonetheless, breakdowns in communication are all too common. Miscommunication cannot only be uncomfortable and embarrassing, but it can also be extremely harmful in certain situations. Please describe a situation of miscommunication you have experienced or witnessed. Indicate the result and offer some ways the miscommunication could have been avoided. Use the strategies mentioned in the lesson to help you.

Answers

Answer:

ill just make something up since im not you: One time i saw someone miscomunicate was when (insert name here) got fired because the data was messed up. or something like that

Explanation:

Which BEST explains why Crawshaw is
willing to consider Denis Clifton's offer?
It is a significant amount of money.
A name change is a simple process.
Clifton is an interesting stranger.
Crawshaw values his own reputation.

Answers

A name change is a simple process

Answer:

yep A name change is a simple process.

Explanation:

Other Questions
Nate needs at least 15 pounds of chocolate to make his chocolate fountain work. He already has 8 pounds of chocolate. What is the smallest amount that he can get to make the chocolate fountain work? Write an inequality and solve. Let c represent the amount of chocolate Nate needs to get. Pls pls help I dont have time HELP ASAP. It also detects if its right or wrong. Part i)Which of the following is the best abbreviation for the word Government?a.) GOVMTb.) GVRNTc.) GOVd.) GOV'TPart ii)In 100 words or less, describe what the U.S Government is/does and why it is/isn't so important. Briefly state your beliefs/views and facts about the U.S Government. You may use any and all online resources to answer this question. Include as much detail as possible in your short answer. Which number is irrational? . Complete the quotation:"I am ...with him in this world" From jekyll and Hyde The function of a retail of purchasing cooperative or "co-op" is toCorrect answer A. obtain lower prices for members.Incorrect answer B. work to improve the image and working conditions of members.Incorrect answer C. save income taxes for members.Incorrect answer D. sell the goods or services produced by members. What does it mean to "Psych yourself up?" How does this term affect the meaning of the text Find three ratlos equivalent to the ratio described in the situationThe ratio of cups of water to cups of milk in a recipe is 1 to 4Three equivalent ratlos are 2 to3 to4 to When a cricket ball is thrown vertically upwards, it reaches a maximum height of 15 metres. (a) What was the initial speed of the ball ? (b) How much time is taken by the ball to reach the highest point ? (g=10 ms -2 What caused president roosevelt to sign into law meat Inspection act? who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life Which value is in the domain of f(x)?f(x) = StartLayout Enlarged left-brace 1st row 1st column 2 x + 5, 2nd column negative 6 less-than x less-than-or-equal-to 0 2nd row 1st column negative 2 x + 3, 2nd column 0 less-than x less-than-or-equal to 47645 How is the idea of freedom presented in Martin luther kings speech? Explain what is meant by "majority opinion".Your answers