which options best summarizes what is expected of citenzens in a democracy

Answers

Answer 1

Answer:

To play an active role in selecting government leaders

Explanation:


Related Questions

change the man is shouting at the children to passive voice​

Answers

The children are being yelled at by the man

Which option from the left column shows how the events of the passage interact over the course of the passage?
1 point
A. Dickey's movements from one career to the next influenced his expression as an author.
B. Dickey's teaching career supported his decision to adjust his path in order to attain success as a novelist.
C. Dickey's educational experiences established his unconventional attitude toward advertising.
D. Dickey's involvement in the wars resulted in him becoming an accomplished poet.

Answers

The correct answer is A. Dickey's movements from one career to the next influenced his expression as an author.

How to explain the information

The passage describes how Dickey's experiences in different careers shaped his writing. For example, his time as a pilot in the Air Force gave him a firsthand understanding of violence and death, which is reflected in his poetry. His work in advertising taught him how to use language to persuade and manipulate, which is evident in his novels. And his teaching career gave him a platform to share his ideas about literature and writing with others.

Dickey's movements from one career to the next gave him a unique perspective on life and the world, which is reflected in his writing. His work is often characterized by its violence, its dark humor, and its exploration of the human condition.

Learn more about author on

https://brainly.com/question/12851463

#SPJ1

has have
haven't
The mobile phone'
lives forever. It 2
hasn't
has have
changed our
become a normal
part of our everyday life. In fact, most people ³
forgotten what life was like without
called from a
it. You probably 4
public telephone box in years. Of course, if you are
aged under 25 years, life 5
changed
at all. Phones 6
always been mobile.

Answers

Answer:

iPhone have advanced

Explanation:

IPhones used to be so expensive and still are but back then they were not what we have today. Today we have more advanced electronic technology which is good for people who work on their phones or do some other important stuff.

Final answer:

The student's question is asking for guidance on correct usage of the auxiliary verbs 'has', 'have', and 'haven't'. These are used in different contexts in the English language to denote different tenses, with 'has' and 'have' often indicating a present perfect tense and 'haven't' being a contraction that indicates a negative present perfect tense.

Explanation:

The context given pertains to the subject of English, specifically the proper utilization of verb tenses and auxiliary verbs such as 'has', 'have', and 'haven't'. The mobile phone has become a normal part of our everyday life is the correct usage because 'has become' is a present perfect tense verb form. In the context most people haven't forgotten what life was like without it, 'haven't' is used as a contraction of 'have not', indicating a negative present perfect tense. For users aged under 25 years, saying life hasn't changed at all is also a negative present perfect tense, indicating that no change has occurred in their lives due to the introduction of mobile phones. Lastly, when stating Phones have always been mobile this uses 'have' properly for a plural subject, in a present perfect tense context, to indicate a condition that has been true from a past period to the present.

Learn more about English Grammar here:

https://brainly.com/question/33729112

#SPJ2

In which situation is one person most clearly obliged to
another? Base your answer on the meaning of obliged.
A
A boss tells an employee what she should do next.
B
A passenger borrows train fare from another passenger.
C
A writer checks a fart in an encyclopedia.
D A parent ignores a screaming child.

Answers

Answer: A

Explanation:

definition of obliged is that it is legally bound meaning absolutely HAVE to do something. Example: Doctors are obliged to treat patients.

Part I (1,00 point)
Choose the letter A, B, c, or D to indicate the word whose underlined part is pronounced differently
from the others. Write your answer in the box below.
1. A. gives B. leaves c. consumers D. likes
2. A. bar B. plane c. large D. cart
3. A. chemistry B. school c. machine D. Christmas
4. A. wicked B. arrived c. wanted D. needed

Answers

Answer:1. Likes. 2 large 3 chemistry 3 needed

Explanation:

Why does Norma call Mr. Steward?
A
B
C
D
to learn more about the button unit
to make sure he never comes back
to learn more about his company
to thank him for the opportunity

Answers

To thank him for the opportunity

what is the main point of essay​

Answers

The main point of the essay is:

Persuade, InformEntertain.

The term essay refers to a persuade piece of writing on a specific topic. The essay is being written for someone who is convinced. They just inform the reader on a specific issue. There are various forms of essays, including argumentative, narrative, descriptive, and expository essays.

The informative article was written in the format that follows. There are body paragraphs in an informative essay that clearly state the major argument of the justify. The purpose of the informative essay is to ensure that the reader understands the issue.

As a result, the significance of the main point of the essay are the aforementioned.

Learn more about on essay, here:

https://brainly.com/question/20426054

#SPJ1

Your question is incomplete, but most probably the full question was.

What is the main point of the essay?

PLEASEEEEE HELPPPPPPPP will give brainliest!!!!!!!

Answers

Answer:

1: people wanted to have serious and dignified pictures

2:it took long time for taking pics so it was awkward to hold smile for long time

3:dental problems were common so people didn't want to show their teeth

What do you think of the sapir-whorf hypothesis? Do you agree or disagree with it and explain why

Answers

Sapir-Whorf hypothesis state that people  are influence by the different language they speaks and culture is determine by languages ones perceptions, and I agree with this

Reasons

people who speak different languages see the world differently because being able to speak different language that indicates that  they have travel and mingle with different people or race that determines our overall perceptions, thoughts as well as activities.

For examples following instructions or when there is caution sign given to control our activities like when there is a sign indicating beware of dogs our behavior and our mindset are unconsciously determined by that sentence and we will careful on how we trade

 Thus our behavior and our mindset are unconsciously determined by our language.

Learn more about Sapir-Whorf hypothesis onbrainly.com/question/30553465

#SPJ1

write an article for publication in the junior graphic on the topic'why candidate do not cheat in exammination.​

Answers

The decision not to cheat in examinations is rooted in the pursuit of knowledge, the commitment to ethical values, and the fear of repercussions.

As the hallways of academic institutions are filled with anticipation during examination season, one fundamental principle remains steadfast: integrity. In the face of temptation, it is crucial to explore why candidates choose not to cheat in examinations.

Firstly, the pursuit of knowledge and personal growth is at the heart of education. Students understand that genuine learning is the key to success, and cheating only undermines their own development.

By embracing the challenge of exams, candidates enhance their critical thinking and problem-solving skills, preparing themselves for future endeavors.

Secondly, ethical considerations are deeply ingrained within our educational systems. Integrity is a core value taught from an early age, emphasizing honesty and fairness.

Candidates recognize that cheating compromises their credibility, tarnishing their academic journey and future prospects.

Furthermore, the presence of robust invigilation measures acts as a deterrent. The fear of being caught and facing severe consequences discourages potential cheaters. Knowing that institutions uphold strict examination protocols creates a level playing field and fosters trust among candidates.

In conclusion, the decision not to cheat in examinations is rooted in the pursuit of knowledge, the commitment to ethical values, and the fear of repercussions.

Upholding integrity ensures the integrity of the education system, fostering a culture of trust and fairness that benefits all stakeholders involved.

For more such questions on ethical values

https://brainly.com/question/26282247

#SPJ11

15. Identify the prepositional phrase in the sentence below. Our crazy dog escaped and wandered all around the neighborhood.
A. Our crazy dog
B. escaped and wandered all
C. around the neighborhood.
D. wandered all around

Answers

The prepositional phrase in the sentence is "around the neighborhood". The correct option is C.

The prepositional phrase in the sentence is "around the neighborhood". A prepositional phrase is a group of words that begins with a preposition and ends with a noun, pronoun, or noun phrase.

In this case, the preposition is "around" and the noun phrase is "the neighborhood". The prepositional phrase acts as an adverb, providing information about where the dog wandered.
It's important to note that prepositional phrases can also act as adjectives, providing more information about a noun or pronoun.

For example, "Our crazy dog" is a noun phrase that includes the prepositional phrase "our", which acts as an adjective to describe the dog as belonging to us.
Understanding prepositional phrases is important for both reading comprehension and effective writing.

By recognizing prepositional phrases in sentences, readers can better understand the relationships between different parts of the sentence. In writing, using prepositional phrases can add detail and specificity to descriptions.

For more such questions on prepositional phrase

https://brainly.com/question/1841317

#SPJ11

What can you infer about the speaker's feelings about the construction of the freeway?
A. They think the freeway is a necessary transportation amenity.

Answers

The construction of new freeways plays a significant role in the development of transportation infrastructure and addressing the growing needs of urban areas in several ways. Firstly, new freeways provide additional routes and capacity to accommodate increasing traffic volumes in urban areas. Secondly, freeways connect different regions within an urban area, promoting accessibility and connectivity. Furthermore, new freeway construction often incorporates modern design elements and technologies, improving safety features and reducing accident rates. Additionally, the construction of new freeways can have environmental benefits.

The construction of new freeways plays a significant role in the development of transportation infrastructure and addressing the growing needs of urban areas in several ways.

Firstly, new freeways provide additional routes and capacity to accommodate increasing traffic volumes in urban areas. As cities expand and populations grow, the existing road networks may become congested, leading to traffic delays and reduced efficiency. By constructing new freeways, transportation authorities can alleviate congestion and improve traffic flow, thereby enhancing overall transportation efficiency and reducing travel times for commuters.

Secondly, freeways connect different regions within an urban area, promoting accessibility and connectivity. They provide efficient links between residential areas, business districts, and other key destinations, facilitating the movement of people and goods. This connectivity fosters economic development by supporting businesses, attracting investments, and creating job opportunities.

Furthermore, new freeway construction often incorporates modern design elements and technologies, improving safety features and reducing accident rates. Freeways are typically designed with wider lanes, controlled access points, and advanced traffic management systems, which enhance safety for drivers and passengers.

Additionally, the construction of new freeways can have environmental benefits. By providing alternative routes and reducing congestion on existing roads, new freeways can contribute to reducing vehicle emissions and improving air quality. Moreover, efficient transportation infrastructure can encourage the use of public transportation and carpooling, further reducing environmental impacts.

In conclusion, the construction of new freeways contributes to the development of transportation infrastructure and addresses the growing needs of urban areas by improving traffic flow, enhancing connectivity, promoting economic development, ensuring safety, and supporting environmental sustainability.

For more such information on: freeways

https://brainly.com/question/26961773

#SPJ8

The question probable may be:

How does the construction of new freeways contribute to the development of transportation infrastructure and address the growing needs of urban areas?

1.1.1. Write two diary entries. The first entry must indicate how Isabel felt before she went to Zolile High and the second entry you must indicate her experience after she visited Zolile High School.​

Answers

Today is the day I am supposed to visit Zolile High School for a potential transfer. I must admit, I am feeling quite nervous about it. The idea of leaving my current school and starting fresh at a new one is intimidating.

I am also worried about fitting in and making friends. What if I don't like the teachers or the classes? What if I regret my decision to transfer? I know it's important to take risks and try new things, but it's hard not to be scared. I hope everything goes well and I can make the best decision for myself.

I can't believe how wrong I was about Zolile High School. I had such a great experience today! The teachers were welcoming and helpful, and the students were friendly and inclusive. I felt like I fit in right away, and I even made some new friends.

The classes were challenging but engaging, and I am excited about the academic opportunities that Zolile High can offer me. I am so glad I took the chance and visited the school. I feel much more confident about my decision to transfer now. I can't wait to see what the future holds for me at Zolile High School.

For more such questions on intimidating, click on:

https://brainly.com/question/28272861

#SPJ11

Complete the following sentences with suitable subject and predicates. 1. A carpenter 2. A rich man 3. The policeman 4. The teacher 5. The car 6. are happy. ​

Answers

1. A carpenter builds and repairs wooden structures.
2. A rich man enjoys a life of luxury and financial security.
3. The policeman enforces laws and maintains public safety.
4. The teacher educates students and helps them develop critical thinking skills.
5. The car transports people or goods from one place to another.
6. People or things can be happy when they experience positive emotions or outcomes.

It's important to note that there are many possible predicates that could be paired with each subject, depending on the context and intended meaning of the sentence. In general, a subject is the noun or pronoun that performs the action of the sentence, while the predicate is the verb and any other words that describe the action or state of being. I hope this helps!

For more such questions on public safety, click on:

https://brainly.com/question/21082629

#SPJ11

I need an example because I honestly have no idea what the question is asking me. "Write a paragraph that includes at least one appropriate transition word or phrase at the beginning of a sentence. For example, you might use a transition to contrast two ideas, introduce an example, or introduce one of several ideas."

Answers

By using appropriate transition words and phrases like "for instance," "on the other hand," and "furthermore," we can effectively communicate contrasting ideas and provide clear examples, resulting in a well-organized and engaging paragraph.

During the summer months, many people flock to the beach to enjoy the sun, surf, and sand. However, it is essential to take necessary precautions to protect oneself from the sun's harmful rays.

For instance, applying a broad-spectrum sunscreen with an SPF of 30 or higher can help shield the skin from both UVA and UVB radiation. Additionally, it is crucial to reapply sunscreen every two hours and after swimming or sweating to ensure continuous protection.
On the other hand, some individuals prefer to stay indoors and engage in various activities, such as reading books, playing video games, or watching movies.

Indoor activities can provide a much-needed break from the scorching sun and high temperatures, allowing people to cool off and relax in the comfort of their own homes.

Furthermore, participating in indoor hobbies can help reduce the risk of sunburn and heat-related illnesses.
In conclusion, whether one chooses to spend their summer at the beach or indoors, it is essential to consider safety measures to protect against the sun's harmful effects.

By using appropriate transition words and phrases like "for instance," "on the other hand," and "furthermore," we can effectively communicate contrasting ideas and provide clear examples, resulting in a well-organized and engaging paragraph.

For more such questions on transition words

https://brainly.com/question/1101400

#SPJ11

What is the effect of opening the text by using the
words secrets, whispered, and pasts?
O A. It suggests that the text will be historical.
O B. It serves to enhance the mood and tone.
OC. It describes the setting to the reader.
OD. It creates a candid atmosphere in the text.

Answers

The effect of opening the text by using the words secrets, whispered, and pasts is that it suggests that the text will be historical.

In literary theory, a text is any object that can be "read", whether this object is a work of literature, a street sign, an arrangement of buildings on a city block, or styles of clothing. It is a coherent set of signs that transmits some kind of informative message.This set of signs is considered in terms of the informative message's content, rather than in terms of its physical form or the medium in which it is represented.

Within the field of literary criticism, "text" also refers to the original information content of a particular piece of writing; that is, the "text" of a work is that primal symbolic arrangement of letters as originally composed, apart from later alterations, deterioration, commentary, translations, paratext, etc. It can even be historical.

Learn more about text,here:

https://brainly.com/question/29784279

#SPJ1

It serves to enhance the mood and tone. Hence the correct option is B.

The words "secrets," "whispered," and "pasts" evoke a sense of mystery, secrecy, and intrigue.

By using these words to open the text, the author is likely creating an atmosphere of anticipation, suspense, or curiosity.

The choice of these words sets a particular mood and tone for the reader, suggesting that the text will involve hidden or undisclosed information, possibly related to personal histories or clandestine events.

The word "whispered" indicates a hushed or secretive manner of communication.

It implies that the information being shared is confidential and potentially intimate.

This can create a sense of closeness between the reader and the text, as if they are being let in on something private or personal.

Learn more about tone here:

https://brainly.com/question/1416982

#SPJ1

local farmingvs industrial farming essay

Answers

Local farming and industrial farming are two vastly different approaches to agriculture. Local farming, also known as small-scale or sustainable farming, is characterized by a focus on locally grown and sold produce, use of traditional farming methods, and reliance on organic and natural fertilizers. Industrial farming, on the other hand, is characterized by large-scale, mechanized farming methods, use of synthetic fertilizers and pesticides, and a focus on maximizing profits.

While industrial farming has the advantage of producing large quantities of food at lower costs, it has numerous negative impacts on the environment, including soil depletion, water pollution, and greenhouse gas emissions. Additionally, the focus on maximizing profits often leads to the exploitation of workers and animals.

Local farming, on the other hand, supports the local economy, promotes sustainable agriculture practices, and helps preserve traditional farming methods. It also produces fresher and more nutritious produce, which is better for consumers' health. Although it may be more expensive, supporting local farmers is an investment in the community and the environment.

In conclusion, while industrial farming may seem more convenient and cost-effective, the negative impacts it has on the environment and society make local farming the better choice for a sustainable future.

For more such questions on industrial farming, click on:

https://brainly.com/question/4293556

#SPJ11

Type the prefix or suffix of the following word and the meaning of the prefix or suffix, as it is used in this word:

Preview

Answers

The prefix in the word "preview" is "pre-".

How is the prefix used in the word?

The term "pre-" signifies "before" or "prior to." When used with "preview," it suggests that something is being presented or exhibited prior to the actual occasion or publishing.

A sneak peek, also known as a preview, is an initial or youthful glance at something, ranging from a film, a commodity, or an occurrence, prior to its formal announcement or demonstration to the general public.

It provides individuals with an initial preview or sneak peek of what is to be expected. The addition of the prefix "pre-" serves to highlight the idea of preparedness or foresight leading up to the primary occurrence.

Read more about prefix here:

https://brainly.com/question/21514027

#SPJ1

Create an Outline (Follow the graphic below) It should be one sentence for each step.
Compose an introductory paragraph and highlight or underline the main idea

Answers

The main idea or thesis of the essay is that technology has both positive and negative effects on society, and its ethical implications need to be examined.

Outline:

I. Introduction

Introduce the topic and provide background information.

State the main idea or thesis of the essay.

Example introductory paragraph:

In today's rapidly evolving digital age, technology has become an integral part of our daily lives, transforming various aspects of society. From communication and entertainment to education and business, technology has revolutionized the way we interact and operate.

This essay explores the impact of technology on society, highlighting its benefits and drawbacks, and delving into the ethical considerations surrounding its use.

The introductory paragraph provides an overview of the essay's focus, which is the impact of technology on society. It sets the stage for the subsequent sections by emphasizing the transformative nature of technology and its pervasive influence in different spheres of life.

By underlining or highlighting the main idea, readers can easily grasp the central theme of the essay and understand the purpose of the subsequent sections.

For more question on thesis visit:

https://brainly.com/question/30041897

#SPJ11

HELP BRAINLIEST !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Your answer would be the bottom one

Answer:

Paula went directly to the alarm Company! That Would Be The 2nd Choice Hope This Helps Have A Nice Day!

Explanation:

Helen Keller, The Story of My Life
Discuss:
1. Since Helen Keller was blind and deaf, tactile imagery becomes a focus in her writing.
Underline the tactile images in this passage.
2. Which images in the passage are more specific: visual or tactile? Support your answers
with reference to the passage.

Answers

Answer:

the effect of load shedding

Briefly discuss what protagonist's actions tell you about her character

Answers

The main character's behavior discloses crucial traits of her personality.

How can this show a protagonist's personality?

With unwavering perseverance and steadfast endurance, she persists through any challenge, proving her unyielding strength in the midst of obstacles.

Her selflessness in lending a hand to those in need and advocating for fairness reveals her innate altruism and unwavering sense of morality.

Moreover, she frequently engages in risk-taking activities that are carefully evaluated, demonstrating her astuteness and ability to strategically assess situations.

She exhibits a notable degree of empathy and compassion by often placing the welfare and contentment of others as her top priority, as evidenced by her conduct. On the whole, her conduct depicts her as a bold, compassionate, and ethically sound person.

Read more about protagonists here:

https://brainly.com/question/684224

#SPJ1

summary of thinking head by Akeem Ajibade

Answers

Nigerian entrepreneur and thinking leader Akeem Ajibade. He is the creator of Thinking Heads, a consulting company that aids businesses in coming up with original summary to their problems.

He thinks that businesses ought to be receptive to fresh methods to solving issues. His strategy for tackling issues is built on the concepts of innovative thinking, teamwork, and experimentation. The notion of "thinking outside the box" serves as the foundation for Akeem's approach to original issue solution.

He exhorts businesses to consider alternative strategies in addition to more established ones. He feels that organisations must be ready to take chances in order to succeed, and that innovation is crucial to keeping one step ahead of the competition. Additionally, he thinks that cooperation is essential for success.

Learn more about  summary  at:

https://brainly.com/question/32025150

#SPJ1

SECTION B QUESTION Z Answer all questions 2.1 Read the poem carefully and then answer the questions which follow. The number of marks allocated to each question serves as a guide to the expected length of your answer. [Composed upon] Westminster Bridge, September 3, 1802'-William Wordsworth 1 Earth has not anything to show more fair: 2 Dull would he be of soil who could pass by 3A sight so touching in its majesty, 4 This City now doth, like a garment, wear 5 The beauty of the morning: silent, bare, 6 Ships, towers, domes, theatres, and temples lie 7 Open unto the fields, and to the sky; 8 All bright and glittering in the smokeless air. 9 Never did sun more beautifully steep 10 In his first splendour, valley, rock or hill: 11 Ne'er saw I, never felt, a calm so deepl 12 The river glideth at his own sweet will: 13 Dear God! The very houses seem asleep; 14 And all that mighty heart is lying still! 21 Choose a description from COLUMN 8 that matches a name in COLUMN A Write only the letter (A E next to the question numbers (2.1.1(a) to 2.1.41d)) in the ANSWER BOOK COLUMN A COLUMN B 2.11. Octave 2.1.2. Sonnet 213. Sestet 2.1.4 Volta A. A dramatic change in thought B. A pair of two successive lines of a poem C. An eight-line stanza, may be the first part of the sonnet D. A poem of fourteen lines E. A six-line stanza, may be the second section of the sonnet 2.2 Choose the correct answer to complete the following sentence. Write only the letter (A-D) next to the question number (2.2) in the ANSWER BOOK. Refer to line 1. ("Earth has not... show more fair.) (the). A. London City. B. Majesty. C Temples. D. St Paul's Cathedral. (1) 2.3 Quote ONE word which describes a person who does not see this beauty. (1) 'More fair' in this line describes the beauty of 2.4 Refer to line 4. (This City now... a garment wear'.) (a) Identify the figure of speech in this line. (1) (b) Explain why this figure of speech is relevant in this poem. (2) 2.5 What is the meaning of 'bare' in line 5, in the context of the poem? (1) 2.6 Name ONE structure covered by the morning sun. (1) 2.7 Refer to line 13. ('Dear God! The... houses seem asleep.') Explain the function of the exclamation mark in 'Dear God!' (1) 2.8 One of the themes of the poem is tranquility and silence. Discuss the theme in the context of the poem. (3) TOTAL: (15)​

Answers

2.1.1 (c) Sestet

2.1.2 (d) A poem of fourteen lines

2.1.3 (e) A six-line stanza, may be the second section of the sonnet

2.1.4 (a) A dramatic change in thought

2.2 (B) Majesty

2.3 The word that describes a person who does not see this beauty is "dull." In line 2, the poem states, "Dull would he be of soul who could pass by." Here, "dull" suggests a lack of sensitivity or appreciation for beauty, emphasizing that someone who cannot perceive the remarkable beauty being described is lacking in depth and soulfulness.

2.4 (a) The figure of speech in line 4 is personification. The line states, "This City now doth, like a garment, wear." By attributing the action of wearing a garment to the city, the poet personifies the city, giving it human-like qualities.

(b) This figure of speech is relevant in the poem as it enhances the imagery and emphasizes the relationship between the city and its surroundings. The city is portrayed as if it has adorned itself with the beauty of the morning, just as a person would wear a garment. This personification conveys a sense of harmony and unity between the city and its natural environment, enhancing the overall majesty and grandeur described in the poem.

2.5 In the context of the poem, the word "bare" in line 5 means "open" or "uncovered." It describes the state of the city without any obstructions or distractions, allowing the viewer to fully witness its beauty. The line states, "The beauty of the morning: silent, bare." Here, "bare" suggests a sense of openness and simplicity, emphasizing the unobstructed view of the city's majestic features.

2.6 St Paul's Cathedral.

2.7 The exclamation mark in "Dear God!" in line 13 serves to intensify the speaker's awe and astonishment. It conveys a strong emotional reaction to the sight of the houses appearing as if they are asleep. The exclamation mark adds emphasis and shows the speaker's profound sense of wonder and reverence. It highlights the religious undertones of the poem, suggesting a spiritual connection to the beauty and stillness of the scene.

2.8 Tranquility and silence are prominent themes in the poem. The poet portrays the city in the early morning, capturing a moment of serene stillness and peacefulness. The phrase "silent, bare" in line 5 and the depiction of the river flowing at its own sweet will in line 12 convey a sense of calm and tranquility. The sleeping houses and the stillness of the "mighty heart" in line 14 further emphasize the theme of tranquility.

Through the absence of noise, hustle, and bustle typically associated with a bustling city, the poem highlights the transformative power of the morning hour. The theme of silence underscores the spiritual and introspective atmosphere created by the beauty of the scene. It invites the reader to appreciate the quietude and find solace in the moment of stillness, suggesting that amidst the urban chaos, moments of tranquility can be found and cherished.

For more such questions on personification, click on:

https://brainly.com/question/23487716

#SPJ11

explain why illustrations and other visual elements can be just as important as the words in a children’s story.

Answers

Answer:

Visual elements could be illustrations, photographs or diagrams. When you are reading a story, illustrations that go with the story can do several things. One of the things that the illustrations can do is to help us better understand the words in the text.

Explanation:

I see the answer to this question, but would like "quotations,citings" from the text book: The Norton Anthology of American Literature (Shorter 10th ed)
Paperback: Volume 1 (1290 pages) AND Volume 2 (1745 pages)
Publisher: W. W. Norton & Company; 10th edition (2023)
Language: English

Post 1: You learned the definition of the American Dream in this week’s lecture. You also learned about the American identity. Traits often associated with the American identity include boldness, confidence, perseverance, and integrity. These traits are often demonstrated through a character’s words or actions. This week, we’ll focus on boldness. How is boldness reflected in the characters of Rebecca Harding Davis’s story? Choose two characters from "Life in the Iron Mills" and explain how boldness applies to them in the story.
include two properly integrated and cited direct quotations (one related to each character) to support your claims.

Answers

The fundamental tenet of "Life in the Iron Mills" is that everyone deserves to be respected. Additionally, they ought to have a manner of life that gives them the freedom to pursue their objectives, to work, and to live comfortably.

The fictional town in "Life in the Iron Mills" is based on the author's native Wheeling, Virginia. The nameless narrator sets the scenario at the start of the story. On a cloudy, rainy day, he depicts the town filled with iron foundries as he stares out of his window.

Deborah and Désirée are brave because they're prepared to go above and beyond to solve issues that could put them at a social disadvantage.

Learn more about Narrator, here;

https://brainly.com/question/17415359

#SPJ1

Since he could already play the guitar.

What is the best way to rewrite the sentence fragment above?

Answers

This revised sentence maintains the original idea that the person in question has a skill in playing the guitar, but adds a question that invites further exploration and expands the context.

To turn the given sentence fragment into a complete sentence, one possible way to rewrite it is: "Since he already knew how to play the guitar, what other musical instrument should he try to learn?"

This revised sentence maintains the original idea that the person in question has a skill in playing the guitar, but adds a question that invites further exploration and expands the context.

By using the word "since," which implies a cause-and-effect relationship, the sentence suggests that the person's existing knowledge of the guitar could influence their decision about what to learn next.

The phrase "what other musical instrument" introduces a sense of curiosity and opens up the possibility of new discoveries.

The sentence could be used in various contexts, such as a conversation among musicians, a personal reflection on learning new skills, or a musical education program that encourages students to broaden their horizons.

Overall, the best way to rewrite the sentence fragment depends on the intended meaning, tone, and audience of the communication.

For more such questions on context

https://brainly.com/question/11247029

#SPJ11

what emotions does the speaker display in the poem fear by eva pickova

Answers

The speaker in Eva Pickova's poem "Fear" expresses a variety of feelings, from trepidation to resistance. The speaker of the poem begins by expressing her worry and how it "creeps in," implying a feeling of dread and uncertainty.

The speaker admits her concern and declares that she will be "strong and brave" in the face of it, exhibiting bravery and resolve. In a later section of the poem, the speaker declares that she will not "bow down" to dread and shows her hatred for it.

This defiance is further emphasized in the poem’s closing lines, in which the speaker declares that she will “not be afraid”. In this way, the speaker’s emotions in the poem range from apprehension to defiance, as she struggles.

Learn more about poem   at:

https://brainly.com/question/12155529

#SPJ1

How many privately owners properties were affected kelp v city city of new London

Answers

There is a total of 15 private owner properties in London

Explain natural discovery and self discovery in the poems you experienced in this unit. Compare two of them for impact, use of imagery, sound devices, figurative language, and complexity of the experience. Include specific details in your evaluation.

Answers

In poems, natural discovery refers to the investigation and adoration of the natural world.

It frequently depicts the speaker's observation of and engagement with nature, which results in insights, feelings, or a deeper comprehension of oneself or the surrounding environment.

This subject matter may inspire awe, serenity, or a sense of connectedness to nature.

Self-Discovery: The speaker's inward journey is the main emphasis of poems about self-discovery. It examines topics like identity, introspection, and personal development.

Self-discovery poetry frequently delves within, expressing the speaker's feelings, thoughts, and realizations about themselves.

An improved knowledge of one's values, purpose, or role in the world can result from this exploration.

Learn more about Natural discovery  here:

brainly.com/question/16022248

#SPJ1

Other Questions
Next year, SUV manufacturers sell more SUVs at a lower price. Which of the following events would have this effect? Select an answer and submit . For keyboard navigation, use the up/down arrow keys to select an answer. a an increase in the price of steel, which is used in the construction of SUVs. b a increase in the price of electric cars. an increase in the number of manufacturers of SUVs. d an increase in the price of gasoline. Which of the following defines non-functional requirements?A. Statements of services the system should provide.B. Constraints on the services or functions offered by the system.C. Requirements that come from the application domain of the system. 14) balance the equation S + 0 => S0 which mineral group has silicon-oxygen tetrahedra bonded in a sheet structure? Suppose you have two similar rectangular prisms. The volume of the smaller rectangular prism is 64 in and the volume of the larger rectangular prism is 1,331 in. What is the scale factor of the smaller figure to the larger figure?4:111:213:109:25 the current republican control of government in texas occurred with the results of the by august 1804, what area of the united states had the expedition moved into? in his famous book, the prince, niccol machiavelli argued that princes must into four patches, estimate the value below. Let H be the hemisphere x2 + y2 + z2 = 43, z 20, and suppose f is a continuous function with f(3, 3, 5) = 13, f(3, -3,5) = 14, f(-3, 3,5) = 15, and f(-3, -3,5) = 16. By dividing (Round your answer to the nearest whole number.) Slaxy f(x, y, z) ds WHATS THE RIGHT ANSWER PLEASE EXPLAIN I WILL MARK YOU BRAINLIEST. .In groups such as cross-functional teams, the key challenge for teams whose members have unique knowledge and expertise ishow to integrate the diverse knowledge of the team members so that it is meaningful to the team's purpose.minimizing conflicts.keeping team members engaged in the project.minimizing costs for the continuing education of its members. a trader has a put option contract to sell 100 shares of a stock for a strike price of $60. consider the following scenarios: i. a $2 dividend being declared ii. a $2 dividend being paid iii. a 5-for-2 stock split iv. a 5% stock dividend being paid. use the information above to answer the following question: what is the effect on the terms of the contract of scenario iv? the put option contract gives the right to sell 95 shares for $56.86 the put option contract gives the right to sell 105 shares for $57.14 no effect. the put option contract gives the right to buy 105 shares for $57.14 the put option contract gives the right to buy 95 shares for $56.86 Circle the section on the dna template where the example primer would bind in the following sequence:3' ATTGCGCATTCCGATGGCTCGGAATAAGGCCGTCCTATTCAT 5'Example Primer: 5' ATTCCG 3' you are an it technician for your company. your boss has asked you to set up and configure the sick role is defined as? group of answer choices the pattern of expectations that define appropriate behavior for the sick and for those who take care of them the social sanctions faced by a person who claims to be sick for too long an illnesses that is questioned or considered questionable by some medical professionals the discriminatory practices used by corporations when an employee takes sick leave Array elements must be ________ before a binary search can be performed.A) summedB) set to zeroC) sortedD) positive numbersE) None of these where is a time-temperature indicator (tti) most commonly found? what is the most compacted form in which dna is found during interphase of the cell cycle? Answer choices A-y=3xB-y=4x-2C-y=-x+5F-y=x+3E-y=-2x-4F-y=x+3 at what level of output will average variable cost equal average total cost?