who is left standing as the play hamlet ends? what is the final scene, and what feeling does it leave us with?

Answers

Answer 1

Nine deaths all, then. Horatio, the sole major character still alive at the conclusion, is technically not standing because he is typically depicted sitting on the ground while holding Hamlet's corpse. Hamlet, however, dissuades him from doing so before going to sleep for the last time.

At the end of the play, is Hamlet mad?

The positive aspect: Hamlet appears insane after learning that his father was dead. Lines 127–134 of Act I, Scene V. He uses "wild and spinning words" at the moment, which Horatio and Marcellus find ridiculous.

What does Hamlet think of death at the end of the play?

Hamlet reaches the conclusion that he isn't sure whether to and runs the risk of not comprehending the mystique of why death is preferable than life in the final portion. He is terrified of death since he doesn't fully understand it, according to the diction and images.

To know more about hamlet visit:

https://brainly.com/question/29549814

#SPJ4


Related Questions

Read the excerpt from act ii of hamlet. he tells me, my sweet queen, that he hath found the head and source of all your son’s distemper. the figurative language in these lines is an example of:_____.
a. a metaphor and an allusion.
b. a simile.
c. an apostrophe.
d. personification.

Answers

Option (a). My sweet queen, that he hath found the head and source  of all your son's distemper. The figurative language in these lines is an example of a metaphor and an allusion.

Hamlet's first soliloquy takes place in act 1, scene 2, when Hamlet is expressing his misery and shock at his mother's new marriage to his uncle. He uses metaphor. Figurative language appears all throughout Hamlet, especially in the final scene when Hamlet force feeds Claudius the wine that Claudius had planned to poison Hamlet with before Gertrude, Hamlet's mother, drank it by mistake. Since Claudius poisoned the wine by dropping a pearl into it, Hamlet asks Claudius, . Hamlet uses many metaphors, including when he calls Polonius a fishmonger in Act 2, scene 2. He knows that Polonius is not a literal fisherman but he accuses Polonius of using private information to bait people. Hamlet also uses metaphors in his famous soliloquy to his friends. when he refers to the sky: "this brave overhanging firmament, this majestically roof, fretted with golden fire.

To know more about Metaphor please visit:

https://brainly.com/question/9418370

#SPJ4

why is acculturation a pressure to second generation immigrants



I need a good quote as well please help I’m stressing

Answers

Answer:

Acculturation is a pressure to second generation immigrants because it represents the process by which an immigrant adjusts to their new culture.

It's important for second generation immigrants to acculturate because they need to learn about their new culture and how to fit in with their new community.

The playwright shows that Alyssa has matured by revealing Alyssa’s —

Answers

By disclosing Alyssa's desire to attempt robotics, the dramatist demonstrates how she has grown up. Hence, option A is correct.

What is the meaning of robotics?

Computer science and engineering have many interdisciplinary subfields, including robotics. Design, build, use, and operation of robots are all part of robotics. Designing tools that can aid and support humans is the aim of robotics.

Designing tools that can aid and support humans is the aim of robotics. Engineering and mathematics are combined in the field of robotics.

Therefore, Option A is correct.

Learn more about robots from here:

https://brainly.com/question/27031413

#SPJ1

The complete question has been attached in text form:

The playwright shows that Alyssa has matured by revealing Alyssa’s —

A decision to try robotics

B reluctance to talk to Samantha in the hallway

C excitement about continuing with orchestra

D acceptance that Samantha is a talented violinist

In scene 3, what "compliment" is Lancelet trying to give Jessica? What is

ironic about Lancelet's speech in lines 10-13?

Answers

He is trying to say she is a "sweet Jew" and a "beautiful Pagan", and says that a Christian might be want her enough that he would 'resort to trickery'. This is ironic, because it is somewhat of a backhanded compliment.

What happened in Act 2 of The Merchant of Venice?Juliet makes a marriage proposal. That afternoon, Friar Lawrence consents to marry Romeo and Juliet. Tybalt informs Romeo in a letter that he wants to exact revenge on the Montagues for interrupting the festivities.The Duke of Morocco is informed by Portia that she is depicted in the appropriate coffin. Morocco picks the gold casket, but it contains a skull with the words "All that glitters is not gold... golden graves do worms unveil," and the prince of Morocco leaves feeling dejected and defeated.Outside of the Capulet orchard is where this scenario is set. After falling in love with Juliet at first sight at the Capulet masquerade ball, Romeo wants to run across her again. He climbs the orchard wall as he hears Mercutioand Benvolio coming.

Learn more about The Merchant of Venice refer to :

https://brainly.com/question/29234285

#SPJ4

15 POINTS AND BRAINLEST PLEASE ANYONE HELP QUICKLYYYY

Choose one character from The Hobbit to study. Create a 3-5 minute speech from the perspective of that character (pretend you are them). 10 extra points for sharing your project in class.
Think about the following to include in your speech:
What was this character’s role in the story? Did they play a major or minor part?
Did they change over the course of the story? If so, how and why?
How would the story be different if this character had not been included?
Why did you choose this character to study?

Answers

Answer:

Hello class, my name is Bilbo Baggins and I am the main protagonist of The Hobbit. As you may know, I was a hobbit who lived a peaceful and uneventful life in my cozy hobbit-hole in the Shire. However, my life changed dramatically when the wizard Gandalf chose me to join a group of dwarves on a quest to reclaim their kingdom from the dragon Smaug.

As the group's burglar, it was my job to sneak into the dragon's lair and steal the Arkenstone, a valuable gem that would help the dwarves negotiate a peace settlement with the other inhabitants of the Lonely Mountain.

Throughout the journey, I faced many challenges and dangers, including giant spiders, trolls, and orcs. I also discovered that I had unexpected bravery and resourcefulness, which helped me to overcome these obstacles.

One of the most significant moments in my journey was when I found the One Ring, a powerful and evil artifact that was being sought by the dark lord Sauron. Finding the Ring changed my life forever, as it marked the beginning of my journey to become a hero and defeat Sauron.

I chose to study myself because I believe that I am a relatable and complex character who embodies the theme of personal growth and self-discovery. If I had not been included in the story, the dwarves would not have been able to reclaim their kingdom and the fate of Middle-earth would have been drastically different.

Thank you for listening to my speech. I hope you have a better understanding of my role in The Hobbit and how I changed over the course of the story.

Explanation:

Hello class,

I have chosen to study the character of Bilbo Baggins from The Hobbit. Bilbo was a hobbit who lived in the Shire, a peaceful and idyllic region in Middle-earth. He was known for his love of comfort and his reluctance to leave the Shire. However, Bilbo's life changed dramatically when the wizard Gandalf and a group of dwarves arrived at his doorstep and convinced him to join them on a journey to reclaim their lost kingdom from the dragon Smaug.

Bilbo played a major role in the story as the main protagonist. He was the one who accompanied the dwarves on their journey and ultimately played a crucial role in their success. Despite his initial reluctance, Bilbo proved to be a brave and resourceful member of the group. He used his quick thinking and stealth to help the dwarves escape danger and defeat their enemies.

Over the course of the story, Bilbo underwent a significant transformation. He began as a timid and timid hobbit, but through his experiences on the journey, he gained confidence and courage. He learned to stand up for himself and others and became a true hero.

If Bilbo had not been included in the story, the outcome of the journey may have been very different. The dwarves would have likely struggled without his help and may not have been able to reclaim their kingdom. Additionally, the story would have been missing the character arc of Bilbo's transformation from a timid hobbit to a courageous hero.

I chose to study Bilbo because I find his character arc to be one of the most interesting and inspiring parts of the story. His transformation from a timid hobbit to a courageous hero is a testament to the power of personal growth and the importance of stepping outside of one's comfort zone.

Thank you for listening.



Brainliest please



Which inference about Gatewood' training can logically be drawn from the paage ?

Answers

The following conclusion on Gatewood's education can be logically inferred from the passage. A Her son offered her advise.

Explanation:"The boy who lives next door" should be changed to "the small boy who lives next door." This could mean that he did not know how to spell or use punctuation properly, or that he had problems recalling the names of his neighbours. Because Gatewood declared in the third and fourth paragraphs, "I don't want to learn anything," and "I'm going to quit," it is also feasible to deduce that he was bored and upset with his training. This could imply that he had little interest in studying or was ready to give up.We can infer from the supplied question that there was an event that had to do with Greenwood's education because she accepted a job, working at the commute, on her son's recommendation.Consequently, we can see that the reasonable conclusion that can be derived from Gatewood's education in the passage is that she received guidance from her son.

To learn more about Gatewood' refer to: https://brainly.com/question/19347442

#SPJ4

Read and complete. Make sure to use green for your answers.
Use a '... and ...' comparative expression to rewrite each sentence.



The boys just won't stop growing. (tall)

The boys are growing taller and taller.


Every year there are more cars on the road. (busy)

Every year the roads get _____________________.


I love spring. Every day the sun stays up a few minutes later. (long)

I love spring. Every day the sun stays up _______________________.


Scientists say the temperature of the Earth is increasing. (hot)

Scientists say the temperature of the Earth ______________________.


The price of food is increasing by the week. (expensive)

The price of food ___________________ by the week.

Help pls!! i have to send it today

Answers

The comparative adjectives to illustrate the information will be:

. "Every year the roads get busier and busier."

2. "I love spring. Every day the sun stays up longer and longer."

3. "Scientists say the temperature of the Earth is getting hotter and hotter"

4. "The price of food is getting more and more expensive by the week."

What is a comparative adjective?

When describing someone or something that exhibits a quality to a greater or better degree than another, we use comparative adjectives. Comparative adjectives include terms like taller, smarter, and slower.

An adjective that compares two individuals or things is referred to as a comparative adjective. When describing someone or something that exhibits a quality to a greater or better degree than another, we use comparative adjectives.

The comparative adjectives taller, smarter, and slower are examples.

Comparative adjectives are used to compare similarities and differences between two nouns, emphasizing the differences between the nouns (which could be things, people, or animals) that they share (size, color, height, velocity, etc).

Learn more about comparative adjective on:

https://brainly.com/question/24796657

#SPJ1

02.02 Language in King’s Letter
3. Over and over again I have found myself asking: "Who worships here? Who is their God? Where were their voices when the lips of Governor Barnett dripped with words of interposition and nullification? Where were their voices of support when tired, bruised, and weary Negro men and women decided to rise from the dark dungeons of complacency to the bright hills of creative protest?"


• Type of figurative language:

• Meaning of figurative language:

• Effect on tone and mood:

• Effect on audience:

Answers

From the text, the type of figurative language can be identified as follows:

Type of figurative language: Parallelism

Meaning of figurative language: The use of similar or repeating words in consecutive sentences for the purpose of emphasis.

Effect on tone and mood: The tone of seriousness is expressed and the mood is solemn.

Effect on audience: The audience feel sad and ready to discover the issues raised by the speaker.

What figurative language is used here?

The figurative language that is used here is parallelism. Parallelism is the repetition of similar words in a string of sentences. In the paragraph above. we can see that some words were repeated for emphasis.

These include words such as Who, and Where. They were used to ask questions that got the reader thinking about the facts that were put forward by the speaker.

Learn more about parallelism here:

https://brainly.com/question/13534196

#SPJ1

Read each title carefully, then select a likely purpose for reading that text.

Beloved, a novel by Toni Morrison:

Hole in My Life, a memoir by Jack Gantos:

Team of Rivals: The Political Genius of Abraham Lincoln, a history by Doris Kearns Goodwin:

Herb Gardening for Beginners: How to Grow Fresh Herbs at Home, Including over 50 Varieties, Recipes and Crafts, a guide by Janet Williams:

Answers

1.The book Beloved by Toni Morrison:- to provide amusement for oneself

2.Jack Gantos' memoir, Hole in My Life: -to get knowledge of a person's life

3.Doris Kearns Goodwin's history, Team of Rivals: The Political Genius of Abraham Lincoln:-to finish an assignment for school

4.Janet Williams' book Herb Gardening for Beginners: How to Grow Fresh Herbs at Home, Including Over 50 Varieties, Recipes and Crafts -to carry out a task as instructed

Who is Toni Morrison?

Here, we see that Toni Morrison's story "Beloved" features Sixo setting up a meeting with Patsy the Thirty-Mile Woman. Since Sixo arrived there before Patsy, the Thirty-Mile Woman, we can infer with certainty that she had difficulty finding the location.

To know more about Toni morrison, click here

https://brainly.com/question/29396647

#SPJ4

In 35 words or fewer, what does director Rupert Goold lose and gain
when he changes the costumes and settings in his interpretation of

Answers

By using diverse cinematic approaches, putting the play in various historical eras or updating the characters, and altering the play text, these directors interpret Shakespeare's text in their films.

What is the purpose of the witches scenes in Macbeth?

Shakespeare's witches praise Macbeth early on in the play as a prophecy who will succeed to the throne. After killing the king and taking control of the Scottish throne, Macbeth overhears them obliquely prophesying his demise.

Rupert Goold, the director, substitutes 20th-century Europe for Scotland in the 11th century. Trench coats and other military garb are worn by the soldiers. They travel through dark underground corridors that are faintly lit and divided by metal folding gates.

Thus, By using diverse cinematic approaches, putting the play.

For more information about purpose of the witches scenes in Macbeth, click here:

https://brainly.com/question/4681974

#SPJ1

In "The burning light," Galarza emphasizes the real, hurting Mexican immigrant communities in 1950-1940's America. In several points of his interview, Galarza has to bring attention back to the people on the recieving end of unfair policies, laws, and discrimination.
what is one connection between the early Mexican immigrant experience and the them on the family, as presented in this article? what connections can be drawn between Galarza's real life and the novel Barrio Boy?
write a race response for the prompt below.​

Answers

A connection between the early Mexican immigrant experience is that many Mexican are exposed to tremendous amounts of stress and trauma in their country, including discrimination, language barrier, etc.

What was the The burning light about?

This endearing memoir recalls her childhood in Vitebsk, the Russian-Jewish market town where she and her husband, Marc Chagall, were raised. Thirty-six pen-and-ink drawings accompany her warm reminiscences of Jewish family life in pre-Revolutionary Russia.

Galarza focuses on the real, suffering Mexican immigrant communities in 1950s America. Galarza must return the focus of his interview at several points to the people who are victims of unfair policies, laws, and discrimination.

Learn more about immigrants on:

https://brainly.com/question/24475673

#SPJ1

How does the archetype of tragic heroine reveal the universal theme?

Answers

Answer:

Antigone sacrifices herself for her beliefs, but she won’t sacrifice her sister either. This reveals the universal theme of responsibility for your actions.

Answer: Antigone sacrifices herself for her beliefs, but she won’t sacrifice her sister either. This reveals the universal theme of responsibility for your actions

The author describes Jerry as having a "curious, most unchildlike persistence. " How is this different from Jerry’s earlier behavior

Answers

Jerry will amend considerably from the start to the top of the story, however, I might not say that he winds up "an assured young man" simply, however. Initially, he's anxious to suit in with the massive boys, and he jejunely clowns around so as to stay their attention.

It does not work. He realizes that he desires specs to swim through the opening within the rock, and his inability to delay gratification could be more proof of his lack of maturity.

He is commencing to be able to arrange, to suppose ahead, to exercise caution, and he's lot capable of delaying the gratification of his desires. In the end, he now does not feel the requirement for the older boys' attention or acknowledgment, however, he will still need his mother's approbation and praise. He "burst[s]" to inform her that he will currently "stay below water for 2 minutes—three minutes, at least."

This sort of bragging and want for her notice and praise remains somewhat immature, however, the actual fact that Kraut doesn't interact with her within the "battle of wills" that she is ready shows that he has, in fact, matured to a point.

To learn more about gratification, visit here

https://brainly.com/question/29608721

#SPJ4

at the beginning of the chapter, the story is interrupted at its most dramatic point. what is the author’s purpose in breaking the story here?

Answers

The author’s purpose in breaking the story here is to refer back to the story of Dan Cody and how daisy was the first nice girl that Gatsby had ever known. It fills the open gaps on their relationship.

An author is the writer of a book, article, play, mostly written work. An author is defined as "the individual who founded or gave life to something" and whose authorship defines responsibility for what was made, according to a more comprehensive definition of the term.

Typically, the original owner of a copyright is the person who created the work, i.e. the author. Joint authorship occurs when more than one individual contributed to the work. The copyright rules vary slightly across different states and localities in the US.

To know more about Author here-

https://brainly.com/question/9260046

#SPJ4

is some former presidents kept unique companions, a clause or phrase

Answers

Is a few former presidents stored particular companions :a clause.

The required details for clause in given paragraph

In language, a clause is a constituent that incorporates a semantic predicate (expressed or not) and a semantic predicate. A ordinary clause includes a issue and a syntactic predicate, the latter generally a verb phrase composed of a verb with any objects and different modifiers. However, the issue is sometimes unvoiced if it's miles retrievable from context, mainly in null-issue language however additionally in different languages, which include English times of the vital mood. A entire easy sentence consists of a unmarried clause with a finite verb. Complex sentences incorporate a couple of clauses which include at the least one unbiased clause (meaning, a clause that may stand by myself as a easy sentence) coordinated both with at the least one established clause (additionally referred to as an embedded clause) or with one or greater unbiased clauses. A number one department for the dialogue of clauses is the difference between unbiased clauses and established clauses.

An unbiased clause can stand by myself, i.e. it is able to represent a entire sentence with the aid of using itself. A established clause, with the aid of using contrast, is reliant at the presence of an unbiased clause.

To know about clause click here

https://brainly.com/question/27892321

#SPJ1

Zach is a representative at a law firm. A visitor enters the office while Zach is talking with a customer on the telephone. Zach should
a.) ask the customer to hold while he finds someone to help the visitor
b.) finish his conversation quickly and then acknowledge the visitor
c.) put the customer on hold until he finished helping the visitor
d.) acknowledge the visitor with a smile and signal that he will help her shortly

Answers

d.) acknowledge the visitor with a smile and signal that he will help her shortly

Why should Zach react in this way?Since Zach is handling a customer over the phone, the other person is not aware of the situation that is going on in the office. So he has to be handled normally. At the same time, the visitor should also be attended or else it will affect the reputation of the firm on account of ignorance and carelessness.Whether the consumers are calling in over the phone or physically visiting your office will determine the best strategy to service them all at once. However, regardless of the situation, every customer ought to be respected and made to feel as though their business is significant to your company.Generally speaking, a person who enters your office comes first, before a phone call. If a call comes in while you are aiding someone in person, you can choose to let it go to voicemail or answer it, collect the caller's number, and call them back once you are done helping the person in person.

Think about an operator dealing with five clients at once. He must ensure that everything:

Get a prompt response

        are continually active

Get immediate resolution

        are directed to the appropriate department if their problem requires          

        additional knowledge from the specialists

#SPJ1

In this  case Zach should acknowledge the visitor with a smile and signal that he will help her shortly.

Hence, Option D is correct

Why should Zach react in this way?

Zach is dealing with a customer over the phone, so the caller is unaware of what is happening in the office. He must therefore be treated normally. The visitor should also be attended to simultaneously; otherwise, out of ignorance and negligence, the firm's reputation would suffer.The ideal way to serve everyone at once will depend on whether customers are calling on the phone or coming into your office in person. However, every customer should be treated and made to feel as though their business is important to your organization regardless of the circumstance.Generally speaking, a phone call happens after a person enters your office.

To know more about Law firm here

https://brainly.com/question/24065393

#SPJ1

PLSS HELP WILL MARK BRAINEST FOR THE CORRECT ANSWER.

Answers

explanation #3 i’m pretty sure hope this helps !

I'm folding up my little dreams
Within my heart tonight,
And praying I may soon forget
The torture of their sight.

What is the effect of the word little in this stanza?

It makes their dreams seem reachable.
It makes their dreams seem realistic.
It makes their dreams seem soothing.
It makes their dreams seem insignificant.

Answers

The option that is the effect of the word little in this stanza is option D: It makes their dreams seem insignificant.

What is the dreams in the poem about?

Georgia Douglas Johnson's poem "My Little Dreams" has a speaker who carries her dreams close to her heart. This shows that she is recalling her dream, but only to herself rather than actually going for it.

Note that She has not finished them, so she can't bear to look at them, which shows regret that she was unable to follow her desire. She is folding and storing them because of this.

Hence, She tells us to constantly go after our goals because if we do not, we can  eventually regret it, just like she did. So the message is to follow your dreams, even if they seem impossible. She emphasizes the idea that one should pursue their aspirations because giving up on them makes one regret them.

Learn more about dreams  from

https://brainly.com/question/18586506
#SSPJ1

Answer:

ITS D

Explanation:

PLEASE HELP 20 POINTS

Read the following summary of Zora Neale Hurston's Their Eyes Were Watching God and identify the common errors when writing about literature.

I really enjoy in Zora's book when Janie comes into her own. I think that Zora shows Janie's growth to her own true self after surviving two terrible husbands and one okay husband with a tragic ending.


It is written in first person.
It is written with contractions.
It is written in past tense.
The author's first name is used.

Choices A and C
Choices B and D
Choices A and D
Choices B and C

Answers

It is written in first person and The author's first name is used in the above given phrase .

Write the summary of "Their Eyes Were Watching God" .

The main character Janie from Zora Neale Hurston's book Their Eyes Were Watching God is frequently referred to be a feminist figure. Although Janie is undoubtedly an independent woman who supports gender equality throughout the narrative, she does not live a stereotypically feminist lifestyle. Janie is frequently humiliated, silenced, disregarded, ostracized, and even physically abused—often as a result of her interactions with the three important men in her life.

Nevertheless, Janie's feminist identity is strengthened by these instances of disempowerment. She endures abuse from Logan, Jody, and Tea Cake, but she comes out of each union stronger and more assured of who she is. Ironically, it's the moments in her life when she can't be a feminist that eventually shapes who she is.

To learn more about feminist check out the link below :
https://brainly.com/question/1092730

#SPJ1

Answer:choices a and d

Explanation:

PLEASE HELP ITS DUE ON MONDAY!!!!!!! I need 3 for Imagery, 2 for Metaphor, and 3 for Flashback, all from A Christmas Carol: Scrooge and Marley! P.S. I need the page number to! PLEASE hurry!!!! This project is worth 100 points!

Answers

Metaphors

"Old Marley was as dead as a doornail."

-

"A small matter to make these silly folks so full of gratitude."

-

"His body was transparent; so that Scrooge, observing him, and looking through his waistcoat, could see the two buttons on his coat behind."

Imagery

"The cold within him froze his old features, nipped his pointed nose, shriveled his cheek, stiffened his gait; made his eyes red, his thin lips blue; and spoke out shrewdly in his grating voice."

-

"His eyes, which twinkled with a faint light when he was angry, now flashed with a fierce light as he muttered to himself"

-

"The cold became intense. He was obliged to stand upon one leg, and to hold on to the chair with one hand"

Flashbacks

"There was a boy singing a Christmas carol at my door last night. I should like to have given him something: that's all."

-

"I was a tight-fisted hand at the grindstone, Scrooge! a squeezing, wrenching, grasping, scraping, clutching, covetous, old sinner!"

-

"I have seen your nobler aspirations fall off one by one, until the master-passion, Gain, engrosses you. I have seen your capacity for good almost crushed by early disappointment."

(I'm sorry, I can't provide the correct page numbers. I used a PDF copy of the book.)

The first step in writing your literary analysis is to select a piece of poetry by Walt Whitman. Carefully read the poem you chose, making note of any literary element of Romanticism that stands out to you. Highlight and make notes on significant details of the poem. In the next part of this task, you’ll choose at least two specific elements of Romanticism from the text to present in your essay. What poem did you choose? Why did you select this poem?

Answers

The world poet of America, Walt Whitman is the modern-day equivalent of Homer, Virgil, Dante, and Shakespeare.

Who was walt Whitman?

He praised democracy, nature, love, and friendship in Leaves of Grass (1855; 1891-2). This colossal work found beauty and comfort even in death and sang praises to the body as well as the soul.

Whitman is regarded as one of America's most important 19th-century poets, along with Emily Dickinson. Whitman had a considerable influence on a wide range of poets, including Ezra Pound, William Carlos Williams, Allen Ginsberg, Simon Ortiz, C.K. Williams, and Martn Espada.

Whitman, who was raised in Brooklyn and was born on Long Island, only had a basic education. Throughout his career, he worked as a printer, teacher, reporter, and editor. Whitman was partially inspired by his travels through the American West when he wrote and self-published Leaves of Grass.

Therefore, The world poet of America, Walt Whitman is the modern-day equivalent of Homer, Virgil, Dante, and Shakespeare.

To learn more about Whitman, refer to the link:

https://brainly.com/question/1534324

#SPJ1

(c) Provide an objective summary of the text. Wite an objective summary of *On Seeing England for the First Time." In providing main ideas and details from the selection, include the author's opinions bu: no: your own.

Answers

Jamaica Kincaid considers a number of subjects relating to England in her essay On Seeing England for the First Time.

Write an objective summary of  "On Seeing England for the First Time."  

The reader is taken on a "personal voyage of thought and discovery" by Kincaid as she masterfully constructs her writing to raise a variety of various issues and topics. Even though the author addresses a wide range of issues, I think the main issue stems from the writer's perception that she was wrongfully forced to adopt a new identity during the British colonial period after losing her original one at a young age.

The use of sarcasm, sentence structure, and metaphorical language by Kincaid draws the reader into her work and engages them on a personal journey that supports her pessimistic portrayal of England. All throughout the work, she expresses her developing loathing for England, comparing it to a "prison" or a "leg of mutton."

To learn more about pessimistic portrayal check out the link below :

https://brainly.com/question/29523080

#SPJ1

In what ways is her newfound friendship with Mai so important to Willow? What does Mai get in return?

Answers

Although Mina from My Name is Mina displays indications of ASD, she is not clearly stated to be on the spectrum like Willow from Counting by 7's and Caitlin from Mockingbird (Autism Spectrum Disorder).

What kind of a plan do Mai and Willow put together?Mai devises a strategy before they return to the police. Dell is persuaded by her to let her mother to list his address as their own after all. After that, Willow can remain with the Nguyens in their garage while the social worker looks for a suitable place for her to live.When Willow's parents are brutally killed in a car accident, she is suddenly left alone in a perplexing world. This book's achievement is that it is not a tragedy. This really weird yet quite lovable girl succeeds in overcoming her sorrow.Although Mina from My Name is Mina displays indications of ASD, she is not clearly stated to be on the spectrum like Willow from Counting by 7's and Caitlin from Mockingbird (Autism Spectrum Disorder).

To learn more Counting by 7's refer,

https://brainly.com/question/28226063

#SPJ4

how is dialogue used in the short story cranes by Hwang Sunwon

Answers

a cry for the two Koreas to reunite and recognize that the 38th parallel does not divide two separate nations.

One of the men said that at Christmas want is keenly felt and plenty rejoices what did he mean give example of want and plenty

Answers

What the man means by that is those who have a lot (plenty) can celebrate Christmas, whereas those who are poor (want) suffer for their poverty even more.

Plenty and want in "A Christmas Carol"

The line under analysis here was taken from the famous story "A Christmas Carol." The man who says it is a gentleman who is trying to get donations to help the poor during Christmas time.

His words mean that Christmas time is only a time for celebration for those have a lot, whose life is abundant with money and comfort. Those who are extremely poor suffer even more during Christmas, as they do not have the food or comfort for a celebration. Imagine going through Christmas without food or heat at home.

We can conclude our answer concerning what the man means about plenty and want is correct.

Learn more about "A Christmas Carol" here:

https://brainly.com/question/12700121

#SPJ1

In act 3, why does mary warren change her testimony and join abigail and the other girls?.

Answers

Warren changed her testimony because she succumbed to the pressure of being falsely accused of being a witch and tried to protect herself.

Abby starts acting as if Mary Warren is "witching" her when she berates the judges and claims that asking her questions is disrespectful. Since Mary is so engrossed in the girls' antics, she is aware that they won't stop until they have "defeated" her. She is aware that Abby will always get her way if she is the ringleader. Mary then joins the girls' side and claims that John Proctor coerced her into signing the devil's book.

To know more about Witchcraft, refer to this link:

https://brainly.com/question/6270871

#SPJ4

In what way does the repeated image of the "eye of a vulture" help to create suspense?​

Answers

Answer:

The eye being closed prevented the narrator from taking the old man's life.

Explanation: The narrator needed the vulture's eye to be open. This helps build suspense because it has the reader's wondering when the narrator will kill the old man.

Answer:he needed the vulture eye to be open

Explanation: this contributes to the suspense because it has the audience waiting on the edge

Read the sentence.

The treasure covered in dust and webs waited beneath the stairs, safely hidden under the mildewing books and tattered old newspapers.

How many adverbial phrases are included in the sentence?

one
two
three
four
exquisite old painting
hanging slightly crooked
over the mantelpiece
commanded our attention

Answers

The sentence, "The treasure covered in dust and webs waited beneath the stairs, safely hidden under the mildewing books and tattered old newspapers." has three adverbial phrases.

What are adverbial phrases?

Adverbial phrases are groups of words that modify verbs, adverbs, and adjectives. The varied parts of speech they modify often makes them confusing or difficult to spot in a sentence.

Adverbial phrases answer questions such as how, when, how often, where, and why.

In the sentence provided, the adverbial phrases are;

in dust and websbeneath the stairs Under the mildewing books and tattered old newspapers

Learn more about adverbial phrases here:

https://brainly.com/question/12356270

#SPJ1


How Technological advances have/ haven’t made people less competent in the wild

Answers

People are becoming less competitive in the wild due to Technological advances.

How will technology impact our society in the future?

It has an impact on people's lives and modifies their communication, learning, and thought processes. It is important to society, and it is difficult to picture life without it now. Technology and society are interconnected, dependent on, and influenced by one another.

Overuse of technology has built a barrier between many people worldwide, increasing isolation, reducing social connection and social skills, and increasing human-to-machine exchanges.

To learn more about Technological advances from the given link

https://brainly.com/question/2166344

#SPJ4

How would you describe the setting of “house taking over”? How does it match the magical realism model?

Answers

The term “magischer realismus,” which translates to “magic realism,” was first used in 1925 by German art critic Franz Roh in his book Nach Expressionismus.

What is magical realism model?

Magischer Realismus (After Expressionism: Magical Realism). He used the term to describe the “Neue Sachlichkeit,” or New Objectivity, a style of painting that was popular in Germany at the time that was an alternative to the romanticism of expressionism.

Roh used the term “magischer realismus” to emphasize how magical, fantastic, and strange normal objects can appear in the real world when you stop and look at them.

He further developed Roh’s concept into what he called “marvelous realism,” a distinction he felt applied to Latin America as a whole.

Therefore, The term “magischer realismus,” which translates to “magic realism,” was first used in 1925 by German art critic Franz Roh in his book Nach Expressionismus.

To learn more about realism model, refer to the link:

https://brainly.com/question/23748006

#SPJ1

Other Questions
Which statement accurately describes how toproperly use a semicolon to join independentclauses? An advantage of the balanced scorecard framework is the ability to automate the flow of information on __________, so that executives are kept fully informed about business performance. original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge. Please help me solve! a dam holds back the water in a lake. if the dam has a small hole 1.4 meters below the surface of the lake, at what speed does water exit the hole? A corporation has the following account balances: Common Stock, $1 par value, $80,000; Paid-in Capital in Excess of Par Value, $2,700,000. Based on this information, the a. legal capital is $2,780,000.b. number of shares issued is 80,000.c. number of shares outstanding is 2,780,000.d. average price per share issued is $3.48. 4. Using the statistics in the following report generated for Community Hospital, calculate (round to two decimal places) the percentage of occupancy for the month of December. Remember to calculate the Total for Patient Care Units (IPSD, Bed Count and Percent of Occupancy). There are some coloured pins in a bag. The pins can be green,yellow, purple, or grey. A pin is going to be taken at random from the bag. The table shows the probabilities of picking a purple or grey pin. The probability of picking a green pin is three times the probability of picking a yellow one. a)Complete the table. There are 14 purple pins in the bag. b)Work out how many green pins are in the bag hormones in the body are not responsible for regulatingA) development B) Growth C) OxygenD) Reproduction Can you see or hear radio waves?A) You can't hear radio waves but you can see them.B) You can see and hear radio waves.C) You can't see radio waves but you can hear them.D) You can neither see nor hear radio waves.D For the following data set, calculate the percentage of data points that fall within one standard deviation of the mean and compare the result to the expected percentage of a normal distribution.{8, 12, 27, 32, 45, 57, 61, 73, 82, 94} Literal Equations help asap !! Which statement best evaluates this response to the writing prompt?Prompt:Write an essay for your history teacher. In this essay, Identify what you believe is the most important reason the American Revolutionary War was fought. Support your claim with reasons and evidence.-Associated Passage:The revolutionary War period was a dark and difficult time for the United States. The war was violent. It was expensive. Independence was never certain. Still, I believe it was the right decision to fight it.A. It is weak because it does not discuss the reasons for war B. It Is strong because it suggests its position rather than stating it directly C. It Is strong because the author uses his or her personal voice D. It Is weak because its language is not appropriate for a teacher when assessing a client, what finding would the nurse interpret as indicating stimulation of the parasympathetic nervous system? (select all that apply.) How did the role of the Interstate Commerce Commission change by 1920? Which of the following choices best reflects the interrelationships of the four categories of balanced Scorecard performance measures? A) Learning and growth Customer Internal business process FinancialB) Learning and growth Internal business process Financial CustomerC) Financial Learning and growth Internal business process Customer D) Learning and growth Internal business process Customer Financial Multiple choiceA. Choice B B. Choice D C. Choice C D. Choice A What are the "posterior poles of the eyes"? The more predictable policy decisions by the Federal Reserve are, the more effective they are in the long run. A surveyor is 980 feet from the base of the world's tallest fountain at Fountain Hills, Arizona. The angle of elevation to the top of the column of water is 29.7 degrees. His angle measuring device is at the same level as the base of the fountain. Find the height of the column of water to the nearest 10 feet.