why did european powers colonize africa in the late 19th century? select all that apply.

Answers

Answer 1

The European powers colonized Africa in the late 19th century for economic, political, and ideological reasons. They wanted to extract resources, expand their markets, demonstrate their power and superiority, and spread their culture and values to the African people.

There were several reasons why European powers decided to colonize Africa in the late 19th century. First, there was a growing demand for raw materials such as rubber, diamonds, and gold. Africa was seen as a source of these valuable resources that could be extracted and exported to Europe. Additionally, the European powers wanted to expand their markets and create new opportunities for trade.

Another reason for the colonization of Africa was the desire for power and prestige. European countries wanted to assert their dominance over the rest of the world, and Africa presented an opportunity to do so. By colonizing Africa, they could show their military and economic strength, and demonstrate their superiority over the African people.

Finally, there was a belief among Europeans that they had a duty to civilize and Christianize the African people. This attitude was based on the belief in the superiority of European culture and values, and the idea that it was the responsibility of Europeans to bring these values to the rest of the world.


To know more about African Colonization visit:

https://brainly.com/question/28186423

#SPJ11

Answer 2

There were several reasons why European powers colonized Africa in the late 19th century. One of the main reasons was economic gain. European countries were interested in Africa's vast resources such as gold, diamonds, and rubber.

Additionally, the Industrial Revolution created a need for raw materials, which Africa could provide. Another reason was the desire for power and prestige. European countries wanted to expand their empires and establish themselves as dominant world powers. Colonizing Africa allowed them to do so.

Additionally, European countries believed in the concept of social Darwinism, which meant they believed in the superiority of their race and culture. They saw it as their duty to "civilize" the "primitive" Africans. Lastly, religion played a role in colonization as well. Missionaries believed it was their duty to spread Christianity throughout Africa. The combination of these factors led to the colonization of Africa by European powers in the late 19th century.

To know more about century visit

https://brainly.com/question/839876

#SPJ11


Related Questions

this trust was established in 1920 by the us congress and sets up a land base for natives who are 50% or more blood quantum of the original inhabitants of the hawaiian islands. a. hawaiian home lands trust b. strategic trust territory of the pacific c. bernice pauahi bishop trust d. ceded lands trust

Answers

Option (a), The trust established in 1920 by the US Congress for natives who are 50% or more blood quantum of the original inhabitants of the Hawaiian Islands is the Hawaiian Home Lands Trust.

This trust was established to provide a land base for native Hawaiians who were displaced from their land due to colonization and the overthrow of the Hawaiian Kingdom. The trust is managed by the Department of Hawaiian Home Lands and is responsible for managing over 200,000 acres of land for the benefit of eligible native Hawaiians. The trust also provides housing assistance and loans for eligible beneficiaries.

This trust was established in 1920 by the US Congress to set up a land base for natives with 50% or more blood quantum of the original inhabitants of the Hawaiian Islands.

Learn more about Hawaiian Home Lands Trust: https://brainly.com/question/21975844

#SPJ11

What is the leading hypothesis for what might have brought about the extinction of the dinosaurs?A. A new diseaseB. Massive volcano eruptionsC. Competition from mammalsD. An asteroid impact

Answers

The leading hypothesis for what might have brought about the extinction of the dinosaurs is D. An asteroid impact.

The Chicxulub Crater, located in the Yucatan Peninsula in Mexico, is believed to have been formed by the impact of a massive asteroid that struck Earth approximately 66 million years ago. The impact caused widespread fires, tsunamis, and extreme climate changes, leading to the extinction of over 75% of all species on Earth, including all non-avian dinosaurs.

The asteroid impact hypothesis is supported by a variety of scientific evidence, including the discovery of the Chicxulub Crater, the presence of iridium, a rare metal that is only found in asteroids, and the presence of glass spheres, which are believed to be formed by the melting of rock due to the intense heat of the impact.  

Learn more about An asteroid impact.

https://brainly.com/question/8123911

#SPJ4

the word bab is the title given to the forerunner of the founder of baha'i. the title means

Answers

Answer:

Although the young merchant's given name was Siyyid 'Ali-Muhammad, He took the name "Báb," a title that means "Gate" or "Door" in Arabic. His coming, the Báb explained, represented the portal through which the universally anticipated Revelation of God to all humanity would soon appear.

The term "Bab" is an Arabic word that means "gate" or "door." In the context of the Baha'i faith, it refers to the forerunner of the founder, Baha'u'llah.

The Bab was a prophet and religious leader in 19th-century Persia who proclaimed himself to be the gate or door to the coming of a great messenger of God. He taught a message of spiritual renewal and social reform, which attracted a large following and also provoked opposition from the ruling powers. The Bab was eventually executed by the government, but his teachings and followers continued to spread, leading to the emergence of the Baha'i faith. The title of Bab is therefore an important one in the history and theology of the Baha'i religion, as it signifies the spiritual lineage and connection between the forerunner and the founder. Answering more than 100 words, the term Bab is a crucial one in the Baha'i faith as it represents the forerunner of the founder, Baha'u'llah. The Bab proclaimed himself to be the gate or door to the coming of a great messenger of God, teaching a message of spiritual renewal and social reform that attracted a large following in 19th-century Persia. Despite facing opposition from the ruling powers, the Bab's teachings and followers continued to spread, paving the way for the emergence of the Baha'i faith. The title of Bab is significant as it highlights the spiritual lineage and connection between the forerunner and the founder, underscoring the unity and continuity of the Baha'i message and community.

To know more about forerunner visit:

https://brainly.com/question/32238543

#SPJ11

the council of trent (1545–63) was convened in order to:____.

Answers

Answer:

define Catholic doctrine and made sweeping decrees on self-reform, helping to revitalize the Roman Catholic Church in the face of Protestant expansion.

what was wwi general anthony mcauliffe's one-word reply when asked to surrender at bastogne?

Answers

McAuliffe uttered one of the most famous one-word replies in military history: "Nuts!"

During World War II, General Anthony McAuliffe was the commanding officer of the 101st Airborne Division, which was tasked with defending the town of Bastogne in Belgium from German forces. On December 22, 1944, German soldiers surrounded the town and demanded the surrender of the American troops.

This simple, slang term was a fitting response from a man who was known for his toughness and tenacity. McAuliffe's defiant response became a rallying cry for his troops, who held out against overwhelming odds for several days until reinforcements arrived.

His refusal to surrender also demonstrated the resolve and determination of the Allied forces during the Battle of the Bulge.

McAuliffe's famous reply has since become a symbol of American resistance and resilience in the face of adversity.

It serves as a reminder of the sacrifices made by the men and women who fought for freedom during World War II, and continues to inspire future generations of Americans to stand up for what they believe in.

For more question on military visit;

https://brainly.com/question/776519

#SPJ11

in the post–world war ii era, the term third world was used to refer to latin america and

Answers

Explanation:

After World War II, the term "Third World" was used to describe countries that were not aligned with the United States or Soviet Union. Latin America was often included in this group of countries that were still developing their economies and struggling with issues such as poverty and political instability. Today, the preferred term for describing these countries is "developing countries."

janissaries were soldiers taken from christian families, converted to islam, and paid:____.

Answers

Janissaries were soldiers taken from Christian families, converted to Islam, and paid a salary by the Ottoman Empire.

The Janissaries were an elite military corps in the Ottoman Empire that existed from the 14th to the 19th century.

They were recruited from Christian families, primarily from the Balkans, through the devshirme system. Young boys were taken from their families, converted to Islam, and trained to become loyal soldiers of the Ottoman Empire.

The Janissaries played a significant role in the Ottoman military and were known for their discipline, loyalty, and effectiveness in combat. They were provided with regular salaries, pensions, and privileges, which made them a distinct social and political group within the empire.

Over time, however, the Janissaries became a powerful and influential force within the empire, often exerting political influence and resisting reforms. Their privileges and resistance to change eventually led to their decline and eventual abolition in 1826 during the reign of Sultan Mahmud II. The Janissary corps was disbanded through a series of purges and reforms as the Ottoman Empire sought to modernize its military and centralize its power.

Learn more about effectiveness here:

https://brainly.com/question/30694590

#SPJ11

in guernica, there is no specific reference to the destruction of basque's capital city, guernica, which was destroyed by air raid on april 26, 1937.
true
false

Answers

This statement is False. Pablo Picasso's painting "Guernica" was created as a response to the bombing of Guernica, the Basque capital, by German and Italian air forces on April 26, 1937, during the Spanish Civil War.

Although the painting does not include specific visual references to the city of Guernica, it is a powerful symbolic representation of the destruction and suffering caused by the air raid. The painting features various scenes of pain, chaos, and despair, with elements such as a grieving woman holding a dead child, a dismembered soldier, a bull, and a horse to symbolize the violence and devastation experienced by the citizens of Guernica. Picasso's use of black and white further emphasizes the somber and tragic nature of the event. In conclusion, while there may not be an explicit depiction of Guernica's destruction in the painting, the artwork is deeply connected to and inspired by the tragic event.

To know more about guernica visit:

https://brainly.com/question/3501902
#SPJ11

homo erectus fossils have been found in africa, asia, and europe.

Answers

Yes, that is correct. Fossil evidence of Homo erectus, an extinct species of hominin, has been discovered in Africa, Asia, and Europe.

Homo erectus is believed to have lived approximately 1.9 million to 100,000 years ago and is considered an important ancestor in human evolutionary history.

The first Homo erectus fossils were found in Java, Indonesia, by Dutch physician and anatomist Eugène Dubois in the late 19th century. These fossils, known as the "Java Man," represented the first evidence of a human ancestor outside of Africa. Since then, numerous Homo erectus fossils have been found in various locations across Asia, including China, Indonesia, Vietnam, and India.

In Africa, Homo erectus fossils have been discovered in sites such as Olduvai Gorge in Tanzania and Koobi Fora in Kenya. These findings suggest that Homo erectus originated in Africa and then dispersed to other parts of the world.

In Europe, fossil evidence of Homo erectus is relatively scarce compared to Africa and Asia. However, notable discoveries have been made, including fossils found in Dmanisi, Georgia, which provide insights into the presence of Homo erectus in Eurasia.

The widespread distribution of Homo erectus fossils across Africa, Asia, and Europe indicates that this species had a significant range and was able to adapt to different environments. It is believed that Homo erectus was the first hominin to disperse out of Africa and colonize different regions, marking an important milestone in human evolutionary history.

Learn more about extinct here:

 https://brainly.com/question/852093

#SPJ11

What did Joseph Stalin want to do with the funds from his wheat exports during the
1930s?
Use the profits to purchase back the land Lenin had given away.
Develop massive industrialization projects.
Provide aid to communist nations to rebuild after the war.
Build up the national savings in case of economic depression.

Answers

Answer:

the answer is B, "Develop massive industrialization projects."

Explanation:

Joseph Stalin wanted to use the funds from his wheat exports during the 1930s to develop massive industrialization projects in the Soviet Union. Stalin believed that the Soviet Union needed to rapidly industrialize in order to catch up with the industrialized nations of the West. He saw industrialization as crucial to the survival and success of the Soviet Union, and he was willing to sacrifice other priorities, such as agricultural production and consumer goods, in order to achieve it.

Stalin's industrialization drive resulted in the construction of many large-scale industrial projects, including factories, power plants, and transportation infrastructure. However, this also had negative consequences, such as the displacement of millions of people from their homes and the implementation of harsh working conditions in factories.

what did the u.s. supreme court rule in 2011 about electronic games?

Answers

Answer:

Brown v. Entertainment Merchants Association, 564 U.S. 786 (2011), was a landmark decision of the US Supreme Court that struck down a 2005 California law banning the sale of certain violent video games to children without parental supervision.

In 2011, the U.S. Supreme Court ruled that electronic games are protected under the First Amendment as a form of free speech. This decision prevented the government from restricting the sale or rental of violent video games to minors.

The ruling took place in the case Brown v. Entertainment Merchants Association (EMA), in which the state of California had attempted to impose a law that would restrict minors from accessing violent video games without parental consent. The Supreme Court found that this law violated the First Amendment rights of the creators and consumers of these games, emphasizing that video games, like other forms of media, have the ability to express ideas and convey messages.

The Court compared video games to other forms of artistic expression, such as books, plays, and movies, and concluded that the same level of protection should be extended to electronic games. It also rejected the argument that violent video games have harmful effects on minors, stating that there was insufficient evidence to support this claim.

This decision was significant in establishing the legal status of video games as a form of protected speech and upholding the right to free expression for both creators and consumers in the gaming industry. It reinforced the importance of safeguarding First Amendment rights in the digital age, even when dealing with potentially controversial content.

Know more about the U.S. Supreme Court  here:

https://brainly.com/question/27825463



#SPJ11

Which was the most important concern of vietnam war hawks?

Answers

Answer:

The hawks felt that America needed to be involved in Vietnam to defeat communism and protect America's way of life. They believed anticommunist South Vietnam needed to be defended and worried about a possible domino effect and threats to America if communism were allowed to expand.

Explanation:

The most important concern of Vietnam War hawks was the perceived threat of communist expansion.

These individuals believed that if South Vietnam fell to communism, it would create a domino effect in Southeast Asia, leading to the spread of communism throughout the region. They saw the conflict as a critical battle in the global struggle against communism, with grave implications for American national security.

The hawks argued that a strong military intervention was necessary to prevent the establishment of a communist stronghold in Southeast Asia, as part of the containment policy against communism. They believed that failure to act decisively would undermine American credibility and embolden communist movements around the world.

To know more about Vietnam War visit:

https://brainly.com/question/30134557

#SPJ2

in 1860 what groups accounted for three-fourths of all foreign-born americans?

Answers

Answer:

Irish and German

Explanation:

In 1860 what groups accounted for three-fourths of all foreign-born Americans? Irish and German

In 1860, three-fourths of all foreign-born Americans were accounted for by two main groups: the Irish and the Germans.

The Irish had been immigrating to the United States in large numbers since the early 1800s due to famine and economic hardship in Ireland. By 1860, the Irish made up the largest foreign-born group in the country, with an estimated population of 1.6 million.
The Germans, on the other hand, began immigrating to the United States in large numbers in the mid-1800s, primarily due to political unrest and economic hardship in Germany. By 1860, the German population in the United States had grown to approximately 1.2 million, making them the second largest foreign-born group in the country.
These two groups, the Irish and the Germans, accounted for a significant portion of the foreign-born population in the United States in 1860, with their cultural, social, and economic contributions playing a significant role in shaping American society at the time.

To know more about Germans visit:

https://brainly.com/question/31567885

#SPJ11

morgan acquired the core of what would be the largest corporation in the world when he purchased

Answers

J. P. Morgan acquired the steel interests formerly controlled by Andrew Carnegie. Hence, Option (a) is correct.

In 1901, J. P. Morgan facilitated the merger of Carnegie Steel Company with several other steel companies, including Federal Steel Company and National Steel Company, to form the United States Steel Corporation.

This merger resulted in the creation of the largest corporation in the world at that time.

Andrew Carnegie was a prominent figure in the steel industry, and his steel interests were a significant component of the company that J. P. Morgan acquired.

Thus, it correctly identifies the steel interests as the core assets that Morgan purchased from Andrew Carnegie.

Learn more about J. P. Morgan here:

https://brainly.com/question/13466511

#SPJ4

J. P. Morgan acquired the core of what would be the largest corporation in the world when he purchased

a)steel interests formerly controlled by Andrew Carnegie.

b)iron interests formerly controlled by Andrew Carnegie.

c) copper interests formerly controlled by Andrew Carnegie

J. P. Morgan acquired the core of what would be the largest corporation in the world when he purchased is steel interests formerly controlled by Andrew Carnegie. Thus, option (a) is correct.

In order to create the United States Steel Corporation in 1901, J. P. Morgan engineered the union of the Carnegie Steel Company with a number of other steel firms, including Federal Steel Company and National Steel Company.

The largest corporation in the world at the time was founded as a result of this merger.

Andrew Carnegie was a well-known person in the steel business, and J. P. Morgan's corporation included a sizeable amount of his steel holdings.

Therefore, option (a) is correct.

Learn more about on Andrew Carnegie, here:

https://brainly.com/question/27903913

#SPJ12

Your question is incomplete, but most probably the full question was.

J. P. Morgan acquired the core of what would be the largest corporation in the world when he purchased

a) Steel interests formerly controlled by Andrew Carnegie.

b) Iron interests formerly controlled by Andrew Carnegie.

c) Copper interests formerly controlled by Andrew Carnegie

the theory insists that the holy spirit's influence extends beyond the direction of thoughts to the selection of words used to convey scripture.

Answers

The belief that the Holy Spirit's influence extends beyond the direction of thoughts to the selection of words used to convey scripture is based on the idea that the Bible is the inspired word of God.

This theory suggests that the Holy Spirit guided the authors of the Bible in their writing, ensuring that the words they chose were not just their own, but also divinely inspired.
Many Christians believe that the Holy Spirit continues to work in this way today, inspiring people to understand and interpret scripture in a way that is in line with God's will. This can be seen in the many different interpretations of scripture that exist within the Christian community.
While some may argue that this theory is based more on faith than on empirical evidence, it remains an important part of Christian theology and understanding of scripture. Ultimately, the importance of the Holy Spirit's role in scripture is in helping believers to understand and live out the teachings of the Bible, and to draw closer to God through its message.

To know more about Bible visit:

https://brainly.com/question/10322222

#SPJ11

Read pages 6 and 7 of the pdf. Choose one person from that page and write a IOP-CAM on a personal account documented in "Voices of the Southern Tenant Farmers Union".
I- What information is in this text?
O- What is the origin of the text?
P- Perspective- From whose perspective is this text written?
C- What is happening during the time this text is written?
A- Who is the audience of this text?
M- What is the purpose of this text?

Answers

The personal account documented in "Voices of the Southern Tenant Farmers Union" provides insights into the experiences of Southern tenant farmers during a particular time period. It showcases the challenges, struggles, and perspectives of individuals involved in the Southern Tenant Farmers Union.

I- The text contains a personal account documenting the experiences of individuals affiliated with the Southern Tenant Farmers Union. It highlights the challenges and struggles faced by Southern tenant farmers during a specific period.

O- The origin of the text is "Voices of the Southern Tenant Farmers Union," which is a documented collection of personal accounts and narratives of individuals involved in the Southern Tenant Farmers Union.

P- The text is written from the perspective of individuals who were part of or affiliated with the Southern Tenant Farmers Union. It provides their personal experiences, viewpoints, and insights into the circumstances they faced.

C- The text is written during a time when the Southern Tenant Farmers Union was active, primarily during the 1930s and 1940s. It covers the period of the Great Depression, the New Deal era, and the challenges faced by tenant farmers in the southern United States.

A- The audience of this text could be historians, scholars, researchers, or anyone interested in understanding the experiences and perspectives of Southern tenant farmers during a specific historical period.

M- The purpose of this text is to provide a firsthand account of the challenges, struggles, and perspectives of individuals involved in the Southern Tenant Farmers Union. It aims to document their experiences, raise awareness about their plight, and contribute to the historical record of tenant farming in the southern United States.

For more such questions on tenant farmers, click on:

https://brainly.com/question/1148638

#SPJ11

the exchange of land for service or money in the middle ages resulted in a political system that:

Answers

The exchange of land for service or money in the Middle Ages resulted in a political system that Created many different types of ties, both horizontal and hierarchal.

The exchange of land for service or money in the Middle Ages resulted in a political system that was based on feudalism. This system granted the nobility the right to own land in exchange for their loyalty and service, including military service. This system provided a way to maintain power and control over the lower classes. The nobles were given full control of their land, including the power to tax the peasants living on it.

This system also granted the King a great deal of power, as he could grant land to loyal followers and could reward them with more land for their loyalty and service. The peasants also had certain rights, such as the right to use the land for their own needs. This system of exchanging land for service or money allowed the nobles and the King to maintain their power, while still providing some protection and rights to the peasants.

To know more about tax , click here:

https://brainly.com/question/12611692

#SPJ4

The Question-

The exchange of land for service or money in the Middle Ages resulted in a political system that___________.

What can you tell about Harriet Tubman from her actions?

Answers

Answer: By her actions you can tell that she is a fearless person that cares about others.

What are two ways that show how Susan B. Anthony was brave
Include links to websites

Answers

Susan B. Anthony was brave as she battled for women's and African American suffrage, or the right to vote. she also spoke out against slavery.

Susan voted in the presidential election of 1872 and was detained as a result. With the passage of the 19th Amendment in 1920, women were finally granted the right to vote.

Bravery was displayed by Susan B. Anthony. She voted even though she was aware that doing so might result in incarceration because she believed it was unfair that women didn't enjoy the same level of freedom as males. Because she fought for what she believed in for most of her life, she demonstrated tenacity.

Learn more about Susan B. Anthony, here;

https://brainly.com/question/14130938

#SPJ1

as a result of shrinking military production, a deep recession followed the end of world war ii. TRUE/FALSE

Answers

False. In fact, the end of World War II brought about a period of economic prosperity in the United States known as the post-war economic boom.

False. In fact, the end of World War II brought about a period of economic prosperity in the United States known as the post-war economic boom. This was due in part to the increase in military spending during the war, which led to an increase in production and employment. After the war, the government continued to invest in industries such as construction and transportation, which further fueled economic growth. While there were some economic downturns during this time, such as the 1949 recession, overall the post-war period was characterized by high levels of economic growth and consumer spending. So, the statement that a deep recession followed the end of World War II is not true.

To know more about economic visit:

https://brainly.com/question/14355320

#SPJ11

the average number of storm-related deaths attributed to flooding from 1985 to 2014 was ________.

Answers

The correct option is B, The average number of storm-related deaths attributed to flooding from 1985 to 2014 was 83.

A storm is a powerful and turbulent atmospheric disturbance characterized by intense weather conditions. It typically involves a combination of strong winds, heavy rain or snow, thunder, lightning, and sometimes hail or even tornadoes. Storms can vary in size, duration, and intensity, ranging from localized thunderstorms to large-scale cyclones or hurricanes.

Storms occur due to the interaction of different air masses with varying temperatures, moisture levels, and pressure systems. Warm air rising and cool air descending create instability, leading to the formation of clouds and precipitation. Thunderstorms, for example, result from the rapid upward movement of warm, moist air in unstable atmospheric conditions, which triggers the formation of towering cumulonimbus clouds.

To know more about Storm refer to-

brainly.com/question/31456170

#SPJ4

Complete Question:

The average number of storm-related deaths attributed to flooding from 1985 to 2014 was ________.

A). 73

B). 83

C). 96

D). 66

english exploration of the north american continent in the 17th century was hindered by

Answers

English exploration of the North American continent in the 17th century faced various hindrances, including Native American resistance, Lack of resources and supplies etc.

Native American resistance: Native American tribes often resisted English colonization attempts, engaging in conflicts and wars to defend their lands and sovereignty.Harsh weather and unfamiliar terrain: The harsh North American climate and unfamiliar geographical features presented challenges to English explorers, especially in regions such as New England and the Northeast.Lack of resources and supplies: English expeditions often faced shortages of essential resources and supplies, including food, tools, and equipment necessary for survival and establishing settlements.Competition with other European powers: The English had to contend with rival European powers, such as the French and the Dutch, who also sought to establish colonies and control territory in North America.Limited financial resources and support: English exploration efforts were sometimes hindered by limited financial backing from the crown or private investors, which restricted the scale and scope of their expeditions.Navigation and mapping challenges: Navigational tools and maps of the time were less precise, making it difficult to accurately navigate and map the vast North American coastline.

To know more about colonization refer to-

https://brainly.com/question/30900919

#SPJ11

what did two union soldiers find before the battle of antietam? did the union take advantage?

Answers

Two Union soldiers found a copy of General Robert E. Lee's battle plans for the Confederate army before the Battle of Antietam. The plans were wrapped around three cigars and were discovered by the soldiers in a field.

The soldiers promptly delivered the plans to Union General George B. McClellan, who used the information to help plan his attack on the Confederates. The Union did take advantage of this intelligence and was able to inflict heavy losses on the Confederates during the battle. The Battle of Antietam was a significant turning point in the American Civil War and remains the deadliest one-day battle in American history with over 22,000 casualties.
Before the Battle of Antietam, two Union soldiers found a copy of Confederate General Robert E. Lee's battle plans, known as Special Order 191. This discovery gave the Union a significant advantage, as it revealed crucial information about the Confederate troop movements and intentions. Union General George B. McClellan, however, was criticized for not acting more swiftly and decisively on the information, which could have potentially led to a more decisive Union victory at Antietam. Nonetheless, the Union was able to stop the Confederate invasion and claimed a strategic victory.

For more information on Battle of Antietam visit:

brainly.com/question/30391182

#SPJ11

known as "the way of the warrior," the strict code of the japanese retainer was called

Answers

Known as "the way of the warrior," the strict code of the japanese retainer was called Bushido.

Bushido, meaning "the way of the warrior," was the strict code of conduct followed by the Japanese retainers, also known as samurai. Bushido emphasized principles such as loyalty, honor, self-discipline, and moral integrity. It served as a guide for samurai in their actions, behavior, and ethical decision-making. The code emphasized the importance of courage, self-sacrifice, and obedience to one's lord.

Samurai were expected to embody these virtues and adhere to the principles of Bushido in their personal and professional lives. The code of Bushido played a significant role in shaping the samurai class and their role in Japanese society, emphasizing a strong sense of duty, martial skill, and moral character.

Learn more about Bushido

https://brainly.com/question/14433989

#SPJ4


Complete Question:

known as "the way of the warrior," the strict code of the japanese retainer was called___.

what motivated the assassin who shot president james a. garfield in 1881?

Answers

The assassin who shot President James A. Garfield in 1881 was motivated by a combination of personal grievances and a deluded belief that his actions would benefit the country.

Charles J. Guiteau
, the assassin, was a mentally unstable individual who believed he had played a significant role in Garfield's election and deserved a political appointment in return. When his requests were repeatedly denied, Guiteau became resentful and convinced himself that God had chosen him to remove Garfield from power.

Guiteau believed that by assassinating President Garfield, he would not only avenge his own grievances but also resolve a political conflict within the Republican Party. He thought that Garfield's death would lead to the elevation of Vice President Chester A. Arthur, whom Guiteau believed would be more favorable to his faction of the party. In reality, Guiteau had little understanding of the political landscape and no direct connection to Arthur or any significant political figures.

His delusions, combined with a history of mental illness, fueled Guiteau's actions in plotting and eventually carrying out the assassination of President James A. Garfield on July 2, 1881.

Know more about Charles J. Guiteau here:

https://brainly.com/question/1912329


#SPJ11

How did Canada's entry into WWII differ from its entry into WWI?

Answers

Answer:

I POSTED MULTIPLE IMAGES. HOPE THEY HELP, MARK AS BRAINLIEST. THANK YOU AND PLEASE

______________ are elements of mughal india at its cultural apex.

Answers

The Mughal Empire in India reached its cultural apex during the reign of Emperor Akbar and continued to flourish under his successors, Jahangir and Shah Jahan.

The Mughal Empire was a powerful and influential empire that ruled over the Indian subcontinent from the 16th to the 19th century. It was founded by Emperor Babur in 1526 and reached its peak under the reign of Emperor Akbar the Great. The empire's architecture, art, and literature flourished during this period. Majestic structures like the Taj Mahal and the Red Fort were built, and the Mughal miniature paintings became highly regarded.

The Mughals were known for their military might, administrative efficiency, and cultural patronage. They established a centralized government, promoted religious tolerance, and implemented various reforms. Akbar introduced a policy of Sulh-i-Kul, or universal peace, which aimed to foster harmony between different religious communities.

To know more about Mughal Empire refer to-

brainly.com/question/18436545

#SPJ4

lthough it represented the greatest single victory of union general george mcclellan's career, there were no celebrations following what 1862 maryland battle, the bloodiest single day of the war?

Answers

The battle in question is the Battle of Antietam, which took place on September 17, 1862. Despite being a significant victory for the Union and a turning point in the Civil War.

There were no celebrations following the battle due to the staggering loss of life. In fact, Antietam remains the bloodiest single day in American history, with over 22,000 casualties. General McClellan's success at Antietam was somewhat marred by his reluctance to pursue the Confederate army and his failure to decisively defeat them. This led to criticism from President Lincoln and ultimately contributed to McClellan's dismissal from command. Despite the lack of celebration, the Union victory at Antietam had far-reaching consequences. It led to Lincoln's issuance of the Emancipation Proclamation, which declared that all slaves in Confederate-held territory were to be freed. It also prevented European intervention in the war and boosted morale among Union troops.

Learn more about civil war from here:

https://brainly.com/question/32019830

#SPJ11

Was the state of north Caroline restricting citizen freedoms?

Answers

North Carolina is a state within the United States, and like other states, it is subject to the Constitution of the United States, which guarantees certain fundamental rights to its citizens, including freedom of speech, religion, and assembly, among others.

That being said, like any government, the state of North Carolina has implemented laws and regulations that may impact the exercise of certain freedoms. It is possible that some citizens or groups may feel that these laws or policies are overly restrictive and curtail their individual freedoms, while others may view them as necessary measures to protect the common good.

in a ______, the greatest wealth, power, and prestige belong to a society's oldest members.

Answers

Answer:

in a gerontocracy

lllllll

Other Questions
2) select the statement that best describes the difference between a gene and an allele.a) genes code for a single protein or a single trait while an allele can code for many traits ormany proteins.b) alleles are found on chromosomes while genes are independent.c) genes express a specific trait while alleles are variations of a particular gene that result in thevariation we see in that trait.d) genes follow mendelian patterns of inheritance while alleles follow non-mendelian patternsof inheritance. which of the following is not one of the development strategies that may be used by developers? multiple choice selling and leasing back the land for the development. owning and managing the real estate after sale. developing the real estate for lease in master-planned development. selling the real estate after lease-up phase. given a 3 percent intrest rate compute the year 6 value of deposits made in years 1 2 3 and 4 of 1700 what fraction of all families headed by african american or latino women lives in poverty? A ball is thrown straight upward with a velocity of 39 m/s. How much time passes before the ball strikes the ground? (Disregard air resistance.) A. 4.0 s B. 1.2 s C. 2.4 s D. 8,0 What is the purpose of state appellate courts?A. They retry cases and allow criminals a second chance to plead innocence.B.They verify that lower state courts have acted appropriately C. They allow the accused to bypass lower courts and grand juries.D. They create new laws requested by voters. I see her back, and reflect it faithfully. She rewards me with tears and an agitation of hands. I am important to her. She comes and goes. Each morning it is her face that replaces the darkness. In Me she has downed a young girl, and in me an old woman Rises towards her day after day, like terrible fish. 15 2.1 Identify the figure of speech in the line 1 and describe the effect it creates 2.2 List the qualities of the mirror mentioned in the first five line of the poem 2.3 From the first stanza find one alteration used by the poet 2.3 Explain the metaphor "the eyes of a little god" in your own words 2.4 mention two things that visits the mirror each day 2.5 Identify three kinds of mirrors in the poem 2.6 Explain the meaning of three kinds of mirrors in 3.5' in your own words 2.7 Identify one antonym used in this poem GRAND TOTAL 35 John Lee's savings account has a balance of $602. after 9 months, what will the amount of interest be at 0.4% per year? (round your answer to the nearest cent). Can anyone help me please Select the correct answer.What is the value of this expression when n approaches infinity?24 - 3 - 2/4 + 403nn+E153n which facility would the nurse rank as the lowest priority to expand when developing a community-based service program for clients with chronic mental illnesses? what is the maximum value of the magnitude of the angle between l and the z axis? express your answer in degrees to three significant figures. a mechanical ball launcher of mass 14kg sits on a frictionless surface and uses a compressed spring to shoot balls of mass 0.1kg horizontally. The potential energy of the compressed spring before firing is 106J. Asumming the spring is massless and the ball launcher is at rest before shooting, What is the speed of the ball immediately after it was shot?a. 45.88m/sb.45.38m/sc.46.38m/sd.46.78m/se.45.08m/s explain briefly the negative impact of lack of information in a business. When choosing the right amount of a public good to supply, the government: A) often fails to provide it, because people have an incentive to understate a good's value. B) often guesses, because people have an incentive to overstate a good's value. C) often provides too much, because people have an incentive to understate a good's value. D) often provides too little, because people have an incentive to overstate a good's value. to relate two fields in a one-to-many relationship, you connect them using a _____. 2. draw an arrow-pushing mechanism to show how we create our product (4-nitrobromobenzene, the ortho product) Specific phobia differs from generalized anxiety disorder in which of the following ways?a: specific phobia is linked to a particular stimulus, whereas generalized anxiety disorder is notb: generalized anxiety disorder is linked to a particular stimulus, whereas specific phobia is notc: a specific phobia is not very upsetting for the suffer, whereas generalized anxiety disorder isd: generalized anxiety disorder is not very upsetting for the sufferer, whereas specific phobia ise: generalized anxiety disorder is classified as s one of the anxiety disorders, whereas specific phobia is not Santiago is a Mexican student and Pierre is an Egyptian student in an exchange program.Both are part of a team competing in an international quiz competition,and they prepare very hard and cooperate with each other despite their cultural differences.This scenario most likely exemplifies the importance of ________ in bringing interracial harmony.A)implicit self-esteemB)a superordinate goalC)pluralistic ignoranceD)the jigsaw technique Using PCR, you wish to amplify the region of interest (bolded) in the DNA sequence below.|-----Region of interest-----|5 ATAGGTGCAGCCATGAGTACCAATATATC . . . GCTCGAGATCGACTACGCGGCTCTCAGC 33 TATCCACGTCGGTACTCATGGTTATATAG . . . CGAGCTCTAGCTGATGCGCCGAGAGTCG 5Which of the following primers would allow for its amplification? Select all that apply.a. Primer 1: 5-CCATGAGT-3b. Primer 2: 5-TGATGCGC-3c. Primer 3: 5-ACTACGCG-3d. Primer 4: 5-CGCGTAGT-3