Greenhouse gases are more complex than other gas molecules in the atmosphere, with a structure that can trap heat. Greenhouse gas molecules in the atmosphere absorb light, preventing some of it from escaping the Earth.
Carbon dioxide is Earth's most important greenhouse gas that works for absorbing and radiating heat. Greenhouse gases absorb heat radiating from the Earth's surface and even circulate it in all directions including back toward Earth's surface.
Carbon dioxide in the atmosphere warms the planet, causing climate change. Human activities have raised the atmosphere's carbon dioxide content by 50% in less than 200 years.
To learn more about Carbon dioxide , here
brainly.com/question/3049557
#SPJ1
iron carbonate (??) - iron oxide (56g) - carbon dioxide (44g)
The mass of iron carbonate is 291 g along with the mass of iron oxide whose mass is 56 g and carbon dioxide whose mass is 44 g.
What is mass , and it's unit gram and what is the mass of iron carbonate?As always studies mass if the amount of matter present in the given object and asset.Also it is truly said that greater the mass of the body ,smaller is the change produced by applying force on the body.Everything we , our eyes witnesses around have a certain amount of mass as a contained quantity.This is only due to mass that we call a body light weighed or heavy body.The mass of iron oxide is 56 gram as FeO = Fe+O = 56 gram , likewise carbon dioxide have the mass 44 gram.To know more about mass visit:
https://brainly.com/question/19694949
#SPJ9
What is feedback?
A) a way in which part of a system's output is decreased
B) a way in which part of a system's output is removed from the system's input
C) a way in which part of a system's output is increased
D) a way in which part of a system's output enters back into the system as input
What do aerobic respiration and anaerobic respiration have in common?
Both begin with glycolysis.
• Both
occur In mitochondria.
• Both require oxygen to proceed.
• Both end with the electron transport chain.
Answer:
both occur in mitochondria
Explanation:
both require oxygen to proceed
Answer:
both occur in mitochondria
Explanation:
edge 2023
officials want to collect a dna sample from a suspect, and to this end gather blood, saliva, hair, and fingernail clippings (all from this individual). dna from which of these materials will demonstrate the same sequence of nucleotides?
The aim of collecting a suspect's blood, saliva, hair, and fingernail clippings is to obtain a DNA sample (all from this individual). The nucleotide sequence in this person's DNA will be consistent throughout all of their cells.
Describe DNA.DNA, commonly referred to as deoxyribonucleic acid, is the genetic material carried by humans and nearly all other organisms. Nuclear DNA, which makes up the majority of DNA, is located in the cell nucleus, with very little DNA being present in the mitochondria (where it is called mitochondrial DNA or mtDNA).
The DNA of an individual can be found in almost all of their cells. The cell nucleus contains the majority of the DNA. All samples of this person's blood, saliva, hair, and fingernail clippings contain the same DNA sequence. The 3 billion bases that make up human DNA are identical in more than 99 percent of people.
Therefore, in order to obtain a DNA sample from a suspect, officials must first collect blood, saliva, hair, and fingernail clippings (all from this individual). The nucleotide sequence in this person's DNA will be consistent throughout all of their cells.
To learn more about DNA from the given link
https://brainly.com/question/16099437
#SPJ9
The South American song is similar to songs from Africa because . . .
Which of the following is the most serious effect of water pollution for humans?
a.
infectious diseases
b.
algal blooms
c.
toxic food chain effects
d.
low-oxygen water
Could someone do theses for me?
The answers include the following:
Water moves through the hydrological cycle by the sun first heating up the water bodies and plants which results in evaporation and transpiration respectively.Carbon moves through the carbon cycle by photosynthesis in which plants produce food.What is Photosynthesis?This is the process in which green plants manufacture their food in the presence of sunlight and ensures carbon is moved in the carbon cycle.
Plants produce food such as glucose which contains carbon and animals take in oxygen and breathe out carbon dioxide via respiration .It also moves through the cycle as a result of combustion of fossil fuels such as coal etc.
Water moves through the hydrological cycle by the sun first heating up the water bodies and plants which results in evaporation and transpiration respectively. The vapor is then condensed to form clouds and then precipitation occurs which results in rain etc.
Read more about Carbon cycle here https://brainly.com/question/12005308
#SPJ1
Heart disease is the leading cause of death among both men and women in the United States.
It is usually caused when a sticky substance called plaque builds up in the arteries. Often, the
only symptoms of heart disease are chest pain or discomfort.
Why do you think heart disease is so prevalent in the United States? How could heart
disease affect other
organ systems?
Heart Diseases prevalent in the United States due to the leading causes of High blood pressure, a High Cholesterol level, diabetes, Overweight and obese, Alcohol overuse are the key factors.
Heart disease could affect other organs as if the heart is weak, blood could not be circulated and pumped properly thus fluid will start filling in kidneys, lungs, stomach, etc. cause swelling in ankles in feet or legs.
Coronary heart disease is most common cause of death, data suggests that over 20.1 million adults age 20 and older have CAD. CAD can occur when arteries that supply blood and oxygen to heart becomes clogged due to fatty materials called plague. Such factors results sudden Cardiac arrest.
Learn more about Heart disease here https://brainly.com/question/24053461
what is the smooth ribosome in your own words
How would you describe the surface of a cell membrane?
The cell membrane also called the plasma membrane is found in all cells and separates the interior of the cell from the external environment. The cell membrane consists of a semi-permeable lipid bilayer.
Cell membranes regulate the transport of substances in and out of cells. The cell surface structure can be viewed as a three-layered structure with the central plasma membrane having certain macromolecular components attached to the outside exoskeleton and other components to the inside membrane cell skeleton.
The outer covering of eukaryotic cells is called the plasma membrane. This membrane is responsible for isolating and protecting the cell from the environment and is mainly composed of a bilayer of molecules such as proteins lipids, and fats. Cell membranes are made up of proteins and lipids. This is because it is mainly made up of lipids. Only certain substances can penetrate. Phospholipids are the most abundant lipid type in membranes.
Learn more about Cell membranes here:-https://brainly.com/question/1768729
#SPJ1
the end‑replication problem (telomere problem) exists in eukaryotic chromosomes and is characterized by the chromosomes shortening with each round of dna replication.
Each replication cycle results in an incomplete replication of the DNA near the extreme end of the chromosome, gradually shrinking the chromosome.
What is the root cause of the eukaryotic chromosome end replication problem?Eukaryotes have linear, rod-shaped chromosomes that have ends as opposed to bacteria, which have circular chromosomes. DNA replication is difficult as a result of these ends. Each replication cycle results in an incomplete replication of the DNA near the extreme end of the chromosome, gradually shrinking the chromosome.
What specifically is the replication issue at the telomere end?Telomeres shorten as a result of regular DNA polymerases' incomplete copying of linear DNA molecules during cell division. The end replication problem is the name given to this [6]. The process of resection and fill-in that occurs during the synthesis of the telomere leading-strand is mostly to blame for this.
To know more about Telomeres end problem visit:
https://brainly.com/question/15238448
#SPJ9
I do this like a math problem right?? just multiply? if not please tell me the answer
Answer:
Yup!
4.3 times 4.3 times 4.3 = 79.507
Explanation:
Hope it helps! =D
Why water and air are compounds while carbon and gold are elements
Controls cell division.
A. Golgi apparatus
B. Lysosome
C. mitochondria
D. nucleus
E. ribosome
F. vacuole
D. Nucleus
The Nucleus controls the cell division.
Nucleus- In terms of genomics, a nucleus is the organelle inside a cell that is membrane-enclosed and houses the chromosomes. The nuclear membrane has a variety of pores that enable the selective transit of specific molecules (such proteins & nucleic acids) to and from the nucleus.
Cell Division- The mechanism through which a cell, known as the parent cell, splits into two cells, known as daughter cells, is known as cell division. Everything inside a cell divides when it divides. The mitochondria also divide together with the chromosomes and nucleus.
Chromosome- The thread-like components known as chromosomes are found in the nucleus of both plant and animal cells. Protein as well as an one unit of deoxyribonucleic acid make up each chromosome (DNA).
To know more about the Nucleus, click on the below link,
https://brainly.com/question/4031640
#SPJ1
how does your body use the protein once it has been ingested? consider the following statements and select the correct ones regarding protein use. select all that apply.
When a protein source reaches your stomach, hydrochloric acid and proteases enzymes convert it into smaller chains of amino acids.
Peptides, that are broken down by proteases, are also what link amino acids. These smaller chains of amino acids go from your tummy to your small bowel.
What happens to the body when it uses protein as a source of energy?However, protein is broken down into ketone bodies to be utilised for energy if the body is not acquiring enough calories from other foods or from the fat stored in the body. The body breaks down excess protein and stores its constituent parts as fat if it is ingested.
Consumed protein is converted to amino acids by the body and then absorbed. It is utilised in the development of muscles and organs, the production of hormones and antibodies, the storage of fat, and the production of energy.
The small intestine is where protein digestion finishes after starting in the stomach. A stomach enzyme called pepsin starts the breakdown of proteins.
Learn more about protein refer
https://brainly.com/question/884935
#SPJ10
1) Which of the following statements best
defines sleep?
Required
O A a. Sleep is a natural result of boredom.
b. Sleep is caused by the production of melatonin and adenosine.
Cc. Sleep is a naturally recurring state characterized by reduced or
absent consciousness, relatively suspended sensory activity, and
inactivity of nearly all voluntary muscles.
d. Sleep restores our brains and makes us feel good.
The statement that best defines sleep is: "Sleep is a naturally recurring state characterized by reduced or absent consciousness, relatively suspended sensory activity, and inactivity of nearly all voluntary muscles."
What is sleep?Sleep is a naturally recurring state of reduced consciousness and decreased sensory activity that occurs in most animals, including humans.
During sleep, the brain and body undergo complex physiological changes, including changes in brain waves, heart rate, breathing, and muscle activity.
This definition captures the essential features of sleep, which include reduced awareness and responsiveness to the environment, decreased muscle activity, and distinct patterns of brain activity.
While melatonin and adenosine are involved in regulating sleep, they do not fully explain the complex phenomenon of sleep. Similarly, while sleep can restore our brains and improve our mood, this is not a complete definition of sleep.
Finally, sleep is not simply a result of boredom, although boredom can make it more difficult to stay awake.
Learn more about Sleep at:
https://brainly.com/question/29759730
#SPJ2
Describe the following levels of protein structure including the types of bonds that are
involved:
a. Primary
b. Secondary
c. Tertiary and Quaternary
The levels of protein structure including the types of bonds that are involved are:
a. Primary - peptide bonds.
b. Secondary - hydrogen bonds
c. Tertiary and Quaternary - Hydrogen bonds, covalent bonds and hydrophobic interactions.
What are the levels of protein structure about?Primary Structure: A protein's distinctive and ordered amino acid sequence is known as its primary structure. It describes the order in which amino acids are added to a polypeptide as it develops during translation. There are essentially an endless number of fundamental sequences with 20 distinct amino acids.
Secondary Structure - It is one where there is a polypeptide chain's that consistent local patterns of coils or folds.
Tertiary Structure : It has a polypeptide's general three-dimensional form as a result of interactions between the R groups of the amino acids that make up the chain.
Lastly, Quaternary Building: It is the form that is produced when two or more polypeptide subunits come together.
Learn more about protein structure from
https://brainly.com/question/4072914
#SPJ1
n the chemical equation for photosynthesis, carbon dioxide and water are converted to glucose and oxygen.
6CO2 + 6H2O ® C6H12O6 + 6O2
Which component could be added to complete this chemical equation?
light energy
ATP and NADPH
chemical energy
rubisco
In order to complete this reaction in the way that it have been Shown in the question, then we need to add the components; ATP and NADPH
What is photosynthesis?The term photosynthesis is used to define the process by which the green plants produce their own food in the presence of sunlight and chlorophyll. In this process, there is the combination of the carbon dioxide and the water molecules which is catalyzed by light from the sun.
We are now trying to see what is going to complete the reaction as shown. We must know that the reaction requires ATP and NADPH to be complete.
Learn more about photosynthesis:https://brainly.com/question/1388366
#SPJ1
Answer: ATP and NADPH
Explanation: W
which kind of molecule is used by organisms to store and transmit genetic material
a. nucleic acid
b. carbohydrate
c. protein
d. lipid
The kind of molecule that is used by organisms to store and transmit genetic material is called the nucleic acid. That is option A.
What is nucleic acid?A nuclei acid is defined as the macromolecule that is found within a living cells that has the ability to transfer the genetic makeup of the organism to its offspring.
The components of the nucleic acid include the following:
Purine or a pyrimidine, A pentose (five carbon) sugar and One to three phosphate groups.The major functions of the nucleic acid include the following:
They aid in transfer of genetic materials to offsprings.Sources of energy in the form of ATP, physiological signaling mediators, secondary messengers, and allosteric enzyme effectors.Learn more about genetic materials here:
https://brainly.com/question/28406985
#SPJ1
A scientist observes an increase in oxygen levels following a volcanic eruption. Explain the sequence of events that makes this possible and identify which of Earth’s spheres are being affected at each step. Your answer should include changes to at least two spheres.
Volcanic eruptions are the expulsion of magma and gases from the interior to the exterior of the Earth. They are caused by plate interaction in the crust and changes in magma and pressure in the mantle.
What are volcanic eruptions?
A volcanic eruption is an expulsion of material rising from the Earth's interior toward the surface. It is an event that occurs when hot magma generated in the Earth's interior rises along the volcano, together with gases that increase the pressure until it emerges to the exterior.
Volcanic eruptions are related to tectonic plate movements. These plates interact and produce new magma by melting solid material. These interactions produce changes in tectonic plates, magma movements, and pressure in the Earth's interior, which is directed to the cortex -the outermost layer-.
The elevated temperatures, and the increase in pressure and magma changes, make it rise toward the surface moving along the volcano until emerging to the exterior. This is how the Erth interior and exterior pressures are equilibrated again.
Let us remember that,
The crust is the most external layer placed upon the mantle and divided into many plates. This layer is part of the lithosphere.The mantle is the second layer of the Earth. It is composed of hot and dense rocky material capable of flowing. Convection currents occur in this layer, rising hot melted material from the deepest region and sinking cold solid material from the surface. This layer composes the mesosphere and the asthenosphere.
Volcanic eruptions increase gases concentration in the exterior, and is a natural cause of atmospheric pollution.
Event Affected sphere
Plate movements crust - lithosphere
Magma changes, mantle - athenosphere
pressure increase
and rising material
You can learn more about volcanic eruptions at
https://brainly.com/question/12409625
#SPJ1
difference between sustainable agriculture and organic agriculture?
Organic farming is focused on the inputs used in production while sustainable farming is focused on the physical treatment of the land .
Organic farming is agriculture that makes healthy food, healthy soils, healthy plants, and healthy environments a priority, along with crop productivity.
Sustainable agriculture relies solely on natural processes for input and recycles nutrients on-site to eliminate the use of non-renewable resources. The main goals of sustainable agriculture are environmental health, economic profitability, and social and economic equity. sustainable agriculture mainly focus to meet society's food and textile needs in the present without compromising the ability of future generations to meet their needs.
To learn more about Sustainable agriculture , here
brainly.com/question/23857554
#SPJ1
which best explains the relationship between flying dragons and trees? a. flying dragons rely on trees for a food source, but not for shelter. b. flying dragons live exclusively in trees except to lay eggs. c. flying dragons burrow into the tree without causing damage to the tree. d. flying dragons use trees for reproduction, but get their food and shelter on the ground.
Answer: late answer but for the other people its B.
Explanation: Flying dragons live exclusively in trees except to lay eggs.
Why does a food like a marshmallow have so little energy?
Answer:
Sugar does not provide a sufficient amount of calories for the body.
Explanation:
Describe each fundamental characteristic of science in your own words.
Observable:
Testable:
Replicable:
Reliable:
Flexible:
heelllppp
Science is based on the observation of phenomena of the real world, testable to be verifiable, replicable and reliable because conducts equal outcomes and flexible due to new evidence may lead to change.
What is science?The word science is a broad term that refers to all body of knowledge based on empirical evidence, which can be tested to be verified and replicated in different experiments. The scientific results must be reliable because it allows generating theories and the development of new hypotheses.
Therefore, we can conclude that science is based on verifiable and replicable facts in experimental procedures. The scientific results are flexible because new evidence may modify old theories.
Learn more about the meaning of science here:
https://brainly.com/question/14054972
#SPJ1
if a medical researcher wanted to prevent communication between cells in order to cure a disease or prevent a malady, how might they achieve that? propose a method that could be used to stop a signal transmission from cell to cell.
Increase ligand production and amplify receptor production and ingest a pharmaceutical form of a ligand.
What are the cells?The corresponding value of all living things are cells. There are numerous billions of cells inside a human body. They give the body structure, reabsorb from meals, turn it into power, and carry out specific functions.
What materials make up cells?Cells are made of water, metal salts, and carbon-based (organic) molecules. Cells are mostly composed of water molecules, which account for at least 70% of their mass. Because of this, knowing the interplay among water and other cell components is essential.
To know more about cell visit:
https://brainly.com/question/12129097
#SPJ9
need help for the other 3 questions, thank you!
1. The other complementary strand of this DNA strand will be:
TAATTTGCTAGGTAGCGTCCA
2. TAA TTT GCT AGG TAG CGT CCA
The amino acid sequence of this strand will be: Stop codon, Phenylalanine, Alanine, Arginine, Stop codon, Arginine, Proline.
3. There are 7 codons in this gene.
4. There are 7 amino acids in this protein.
What are amino acids?Special chemical compounds known as amino acids are used by living things to build proteins. Nitrogen, oxygen, hydrogen, and carbon make up the majority of the elements in amino acids. Twenty distinct types of amino acids are used in the creation of proteins in our body. Some amino acids are actually made by our bodies, while the rest must come from diet.Transcription is the first stage of protein synthesis. At this point, the cell copies (or "transcribes") the DNA. Because it makes use of ribonucleic acid, a different kind of nucleic acid, the copy of DNA is known as RNA. The next procedure is known as translation, and it makes use of RNA.Translation is the following stage in the production of a protein. This is the process by which the RNA is changed (or "translated") into a series of amino acids that constitutes the protein.A complicated mechanism in the cell called the ribosome performs the translation process, which creates the new protein from the RNA instructions.To learn more about Amino acids, refer to:
https://brainly.com/question/14583479
#SPJ13
suppose an organism is extirpated from a local environment. In what way might other organisms be affected? Provide examples to support your answer.
An ecosystem's species are linked by intricate "food webs" of eaters and eaters. When a species goes extinct, neither its predators nor its prey can consume it anymore. These populations change, and others are affected. Such "cascades" of impact can be unpredictable and occasionally fatal. This would happen if an organism is extirpated from a local environment.
What does extirpated means?Extirpation is the local extinction of a species or organism, where it/they stop existing in a specific location yet still survive elsewhere. For the survival of a species, what does extirpation mean? We limit the genetic diversity of organisms by eradicating local populations through human-mediated activities. Expungement brought on by excessive hunting, fishing, agriculture, pollution, the introduction of invasive species, and the destruction of habitat. The current loss of biodiversity brought on by humans cannot be reversed by speciation until hundreds of thousands of years have elapsed since the evolution of new species is a lengthy process. The International Union for Conservation of Nature (IUCN) formally proclaimed magnificent forest frogs to be extinct in 2020. Unlike some species that have vanished entirely as a result of natural disasters, this species' extinction was also a result of human activity.
Examples include the whooping crane, the swift fox, and the leatherback sea turtle. a species of wildlife that once lived freely in Canada but is now extinct. Examples include the population of grey whales in the Atlantic Black-footed ferret, fish, and gravel chub a species of animal that is extinct.
To know more about extirpated, visit:
https://brainly.com/question/17404308
#SPJ9
the creation, modification, and shipping of proteins that are released from the cell happens in this/these organelle(s) found in large quantities in hormone and enzyme producing cells of the pancreas.
The creation, modification, and shipping of proteins that are released from the cell happens in Rough Endoplasmic Reticulum (RER) and Golgi Apparatus organelle(s) found in large quantities in hormone and enzyme-producing cells of the pancreas.
Rough Endoplasmic Reticulum (RER) are have ribosomes attached to their outer membrane. These ribosomes are referred to as the protein manufacturing place of a cell. The ribosomes are the site where tRNA brings amino acids to code with the mRNA so that proteins can be produced. Hence, the creation of proteins occurs in the Rough Endoplasmic Reticulum (RER) of a cell.
The proteins, after creation, are sent to the Golgi apparatus which carry out the function of modification and transport of proteins. Without post-translational modifications, a protein will not be able to travel outside of the cell.
To learn more about proteins, click here:
https://brainly.com/question/10363917
#SPJ4
Explain what a keystone species is and why they are essential to a particular ecosystem. How do keystone species
factor in the overall food web of that ecosystem?
A keystone species is an organism that enables outline a whole ecosystem. By retaining populations of mussels and barnacles in check, this sea famous person enables make sure healthful populations of seaweeds and the groups that feed on them—sea urchins, sea snails, limpets, and bivalves.
A keystone species exerts top-down impact on decrease trophic degrees and forestalls species at decrease trophic degrees from monopolizing crucial resources, which includes opposition for area or key manufacturer meals sources. This paper represented a watershed withinside the description of ecological relationships among species.
Keystone species preserve collectively the complicated internet of relationships in an ecosystem. They may be animals, plant life or microorganisms. Examples of keystone species consist of starfish, sea otters, wolves and elephants.
To learn more about ecosystem here
https://brainly.com/question/13979184
#SPJ1
What is the role of NADPH in CO₂ reduction?
A redox pathway is represented by the dark reactions. As CO2 is reduced to glucose, NADPH gets oxidized to NADP+.
NADPH does it lessen CO2?During the Calvin-Benson cycle, carbon dioxide from the atmosphere is transformed into glucose. Utilizing the electrons made accessible by the oxidation of NADPH, calls for the total reduction of CO2. So, a redox pathway is represented by the dark reactions. As CO2 is reduced to glucose, NADPH was oxidized to NADP+.
What function does NADPH perform?All organisms require nicotinamide adenine dinucleotide phosphate (NADPH) as an important electron donor because it supplies the reducing energy needed for anabolic processes and redox balance. NADPH homeostasis is controlled by a variety of signaling channels and various metabolic enzymes that change adaptively in cancer cells.
Does NADH lessen CO2?The equilibrium predicted per thermodynamic considerations, which is likewise attained from the formic acid side, is obtained during the enzyme-catalyzed CO2 reduction by NADH. The Michaelis constant with CO2 is around 40 mM, reflecting the enzyme's poor affinity for this substrate.
To know more about NADPH visit:
https://brainly.com/question/14870384
#SPJ10