write all products and relevant tests and observations when KOH reacts with NH4NO3​

Answers

Answer 1

Answer:

get a bucket and a mop that's a wap that's wap I'm talking wobble wobble wobble that's a wap


Related Questions

A sound wave moves from a solid material into a liquid. What would happen to the frequency of the sound?

Answers

The frequency of the sound waves travel faster and more effectively in liquids than in air and travel even more effectively in solids.

How many grams are in 7.5 moles of C6H12?



Group of answer choices

0.09g

630g

11.2

84g

Answers

Answer:

630gC₆H₁₂

Explanation:

How many grams are in 7.5 moles of C₆H₁₂?

C₆:12.011×6=72.066

H₁₂:1.008×12=12.096

72.066+12.096=84.162

84.162g/mol C₆H₁₂

7.5 molC₆H₁₂ ×84.162g/molC₆H₁₂= 631.215gC₆H₁₂

If you have 2.0 moles of sodium chloride (NaCl), what is its mass in grams?

Answers

Answer:

117g

Explanation:

Given parameters:

Number of moles = 2moles

Unknown:

Mass of NaCl  = ?

Solution:

To solve the problem, we need to use the expression below;

    Mass of NaCl  = number of moles x molar mass

Molar mass of NaCl  = 23 + 35.5  = 58.5g/mol

 

So;

Insert the parameters and solve;

     Mass of NaCl  = 2 x 58.5  = 117g

Which of the following is an intensive property?

Mass
Magnetism
Shape
Volume

Answers

Answer:

I believe its A. Mass

Explanation:

An intensive property is a property of matter that depends only on the type of matter in a sample and not on the amount. For example, the electrical conductivity of a pure substance is a property that depends only on the type of substance. Silver, gold, and copper are excellent conductors of electricity, while glass and plastic are poor conductors.. Other intensive properties include color, temperature, density, and solubility.

Answer:

B. Magnetism

Explanation:

Hope this helps! :))
Sorry for late answer

How can magnetic force be exerted on objects?

1)Over a distance and anytime an object is in a magnet's field of influence.

2)Only through objects.

3)Only by touching an object.

Answers

I think the answer is : 1

Help me please:(:(:( with my bellwork
for brainiest

Answers

Answer:

Elements are made of only one kind of atom

Compounds are made of 2 or more elements chemically bonded together

Explanation:

Its right there????

How to we measure energy?

Answers

Answer:

The official measurement unit for energy is the Joule (J). Among the most common units measuring energy mention should be made of the kilowatt/hour (kWh), used especially for electric energy (in fact it is used to calculate electricity bills).

With joules hope I helped

5. Which of the following elements will have a charge of 4+ or 4- as an ion?

Answers

Answer:

The answer would either be Carbon or Silicon.

Explanation:

You have discovered an element that is a poor conductor of electricity, has a low melting point, and is a gas at room temperature. How would you classify this element?


A.metal

B.metalloid

C.actinoid

D.nonmetal

Answers

AHHH ITS B SORRY I ACTUALLY KNOE THIS

how to find the electron in an atom/element

Answers

Answer:

to find the number of electrons an element has locate it on the periodic table of elements find the atomic number and note the number of protons because they are naturally electrically neutral

Answer:

M-A=N

Explanation:

M-A=N

Here is an example.

The equation above means that the atomic number (A) subtracted from the average atomic mass (M) equals the combined amount of neutrons and protons. Since we know that 35 17Cl is Chlorine (this is because Chlorine (Cl) is the 17th number on the periodic table and has the average atomic mass of 35), we can insert our data into the equation and end up with the following:

35-17=18.

From here, we can tell that we have a mix of neutrons and protons, with the total being 18. Since the atomic number is 17, we can reasonably assume that there are 17 protons and 1 neutron.

But we still need to find the number of electrons. Fortunately, the number of electrons is always equivilant to the number of protons and the atomic mass, so we know that the number of electrons is 17.

So, we have;

17 Protons

1 Neutron

17 Electrons

Explain why the electron configuration of 2-3-1 represents an atom in an excited state?

Answers

Answer:

See explanation

Explanation:

If we look at the electron configuration closely, we will discover that the element must have had a ground state electron configuration of 2,4.

This is because, the innermost shell usually holds two electrons while the outer shells hold eight electrons each. The four electrons must be accommodated in the second shell in the ground state configuration of the compound.

However, when the atom is excited, one electron from this shell may move to the third shell to give the excited state configuration 2-3-1 as shown in the question.

HELPPPPPPPPPPPPPPPPPPP

Answers

Answer:

not sure about the first one, but i know SDS provides information about the last 3.

Explanation:

How much oxygen (O) is in 5.41 × 106 atoms of oxygen

Answers

Answer:

They show you  how to do it sweetie

Explanation:

123456789 Common math

explain how to separate sugar from supersaturated sugar solution
guys pls help

Answers

A “supersaturated” solution contains more dissolved material. supersaturated solutions lies in the temperature of the water. more sugar will dissolve in hot water than in cold. Meaning that by separating the 2, only the supersaturated sugar would dissolve leaving the regular sugar untouched.

The chemical equation describing the burning of hydrogen gas is: 2H2 + O2 ---> 2H2O.
Why is this both a synthesis and a combustion reaction?

Answers

Answer:

"A combustion reaction is a reaction in which a substance reacts with oxygen gas, releasing energy in the form of light and heat. Combustion reactions must involve O2 as one reactant. The combustion of hydrogen gas produces water vapor." and "A synthesis reaction occurs when two or more reactants combine to form a single product. ... In a double replacement reaction, two compounds exchange elements. A combustion reaction occurs when a substance reacts quickly with oxygen. Combustion is commonly called burning"

Explanation:

I tried

A nitrogen molecule (N2) has one triple bond. How many electrons do the nitrogen atoms share?

A. 1
B. 3
C. 4
D. 6

Answers

Answer:

3 electrons

Explanation:

Which will diffuse the most? The particles with the
A. Least potential energy.
B. Most potential energy.
C. Least kinetic energy.
D. Most kinetic energy.

Answers

Answer:

B. Most potential energy

Explanation:

brainest plz

Are the atoms really "sharing" electrons

Answers

No they are donating them

a flask of 0.30 L was weighted after it had been evacuated.It was then filled with a gas of unknown molecular mass at 760 mm of Hg and temperature of 300 K. The increase in mass of flask was found to be 0.997 g. Determine the molecular mass​

Answers

The molecular mass​ : 81.72 g/mol

Further explanation

In general, the gas equation can be written  

[tex]\large {\boxed {\bold {PV = nRT}}}[/tex]

where  

P = pressure, atm , N/m²

V = volume, liter  

n = number of moles  

R = gas constant = 0.082 l.atm / mol K (P= atm, v= liter),or 8,314 J/mol K (P=Pa or N/m2, v= m³)

T = temperature, Kelvin  

P = 760 mmHg=1 atm

T = 300 K

V = 0.3 L

Number of moles :

[tex]\tt n=\dfrac{PV}{RT}\\\\n=\dfrac{1\times 0.3}{0.082\times 300}\\\\n=0.0122[/tex]

The molecular mass (MW) :

[tex]\tt MW=\dfrac{mass}{n}\\\\MW=\dfrac{0.997~g}{0.0122}\\\\MW=81.72~g/mol[/tex]

Someone please help will mark as brainliest

Answers

1. solute is the substance that is being dissolve,while solvent is dissolving medium

2.saturated is solution that contain maximum amount of solut that capable of being dissolve and supersaturated is solution that contain less amount or medium of solut that capable being dissolve : example vinger

3. is a number placed in front of a chemical symbol or formula. It shows how many atoms or molecules of the substance are involved in the reaction. For example, two molecules of hydrogen would be written as 2 H2, and two molecules of water would be written 2 H2O . yes it's can be change only in caseWhen you balance an equation you can only change the coefficients

Given a balanced chemical equation it is always possible to determine
A)
the physical state of the products and reactants
B)
whether a reaction will or will not take place
C)
the relative number of moles taking part in the reaction
D)
the conditions necessary for the reaction to take place

Answers

Answer:

C)  the relative number of moles taking part in the reaction

Explanation:

From a balanced chemical equation, it is always possible to determine the relative number of moles taking part in a chemical reaction.

The number of moles is the amount of the reacting specie that makes up a chemical reaction.

In balanced chemical equation, the number of moles of reactants and products must be the same. From this understanding, we can determine the amount of reactants and products needed for a chemical reaction to take place.

What happens when a virus becomes latent?

Answers

Answer:

the full viral genome is retained in the host cell, but its expression is dramatically restricted, such that few viral antigens and no viral particles are produced.

Explanation:

Not much viral particles are made

the force that holds paticles together in the atomic nuecleaus?

Answers

Explanation:

i believe you meant particles*

DRAW A PEDIGREE

Read the following information and ON NOTEBOOK PAPER, construct a pedigree using the symbols we went over Tuesday: Scott is married to Christa. They have 3 children, Blake (a son), Peyton (a daughter), and Ashton (a daughter). Blake is married to Allie and they have 2 children, Henry (a son) and Harper (a daughter).

When you have completed your pedigree drawing, take a picture and attach it to this assignment and submit.

Answers

Answer:

Here you go

Explanation:

What is a mixture of sugar and water?

a solution

molecule

a compound

a precipitate

Answers

Explanation:

I think its a solution just me tell me in comments if right

Answer:

A solution

Explanation:

Sugar is soluble in water and would dissolve into the water to form a solution.

Susan is investigating physical changes. To do this, she places some ice into a large bowl and seals it with a lid. She leaves the bowl on the counter for several hours until all of the ice has melted. Using a balance, Susan determines that the mass of both the water and the ice are equal. Why is the mass of the ice and the water the same? (SC.8.P.9.1)

Answers

Answer:

No mass loss

Explanation:

The mass of ice and the water in the different state are equal because the same of quantity of matter is present in both state of matter of matter.

In essence, the mass of the physical change process is conserved. When mass is conserved, matter is neither created nor destroyed but can be changed from one form to the other. This is in compliance with the law of conservation of matter. So, no mass was lost in the physical change process and the mass will remain the same.

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

Someone please help will mark as brainliest

Answers

Answer:

a1

The main difference between SPECT and PET scans is the type of radiotracers used. While SPECT scans measure gamma rays, the decay of the radiotracers used with PET scans produce small particles called positrons. A positron is a particle with roughly the same mass as an electron but oppositely charged.

Explanation:

a2

While imaging tests such as X-rays can show what the structures inside your body look like, a SPECT scan produces images that show how your organs work. For instance, a SPECT scan can show how blood flows to your heart or what areas of your brain are more active or less active.

a3

PET and SPECT have been extensively evaluated as diagnostic procedures for dementia. Substantial progress has been made in developing radioligands that bind to amyloid deposits in the brain, which should provide new opportunities for early diagnosis and treatment monitoring in Alzheimer's disease

a4

What are the disadvantages of spect as compared to pet?

However, SPECT has issues, including long scan times and low-resolution images prone to artifacts and attenuation. Some artifacts can easily be misidentified as perfusion defects. SPECT also does not provide a quantifiable estimate of the blood flow, whereas PET does, experts say.

Can farmers simply plant more acres of crops to feed a growing population?

Answers

Answer:

I believe they can if it's a small town/village

Explanation:

How many molecules are equal to 3.25 moles of carbon dioxide?

Answers

Answer:

1.957 × 10²⁴ molecules

Explanation:

The number of carbon dioxide molecules can be found by using the formula

N = n × L

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 3.25 × 6.02 × 10²³

We have the final answer as

1.957 × 10²⁴ molecules

Hope this helps you

Other Questions
Please help I is so confused!!What impact does the economy have on distribution and consumption? Describe a realistic way that the United States could have fixed this issue of freedom not being different Calcular el valor de x en la siguiente figura What type of sentence is this sentence? We can only speak of people Whose roots in America are older or newer.a. simpleb. compoundc. complexd. compound-complex 20 POINTS!!Kinetic and Potential Energy Exploration brought Europe and the Americas in contact with one another. This resulted in the movement of people, plants, animals, and germscalled the Columbian Exchangethat changed life on both continents. Was the Columbian Exchange good for the world? Write an essay for your teacher and peers in which you argue your view. Where can the element iron be found in nature? Where is the gene for eye color found in a cell Do you believe that anyone is able to murder in the right situation at the right time like if you daughter was about to be murdered but the only way to stop them was to murder them and you do it do believe you should go to jail please answer both parts of the question Need help needs to be done by 10:00pm: Find the errors in each sentence and correct them.1. Soy altos y morenos. (2)2. Paco es atrevida. (1)3. Nosotros es joven. (2)4. Mi madre es simptico y delgados. (2)5. Mis primas es bajo. (2) The Great Lakes are located:A. In QubecB. In FloridaC.on the Ontario-US borderD. on the US-Mexico border Find the sum of the roots of the quadratic x^2 + 7x - 13 = 0 The political cartoons above are a representation of which of the following? What does Joann need to change in her outline? Check all that apply. She needs to remove Step 1. She needs to add "Highlight the content" as Step 2. She needs to change the name of the icon in Step 3. She needs to revise Step 4. Many ladybird beetles live in Pedro's garden. He observed them one summer for a science project. Pedro noticed that all the ladybird beetles had red shells. Some of the beetles had many dark spots, some had only a few dark spots, and one or two beetles had no dark spots at all. Around the same time, Pedro's father replanted the garden using just red flowers. A few years later, Pedro observed the ladybird beetles again. This time he noticed that almost all the ladybird beetles had shells with more red visible. They had few or no dark spots on their shells. Pedro concluded that replanting the garden with red flowers caused a change in the ladybird beetle population. Which best explains Pedro's observations? 4. What does doubling the voltage do to the strength of the electromagnet? Which ordered pair is on the graph of y = 4x + 3? How is the peace movement participating in the political process?!! ASPPP 61 POINTSSS!!! Read the statement about Mount Vesuvius. Mount Vesuvius erupted in 79 CE and destroyed the ancient city of Pompeii. Why is the statement free of bias? It is based on opinion. It is a fair statement of fact. It expresses one specific view. It exaggerates details of the event. Explain good or ill report Which is a factor pair of 72 ?A. 12, 6B. 14, 5C. 23, 4D. 24, 2