Write an equation for the line in the given form.
Contains the points (2,8) and (3, 11); slope-intercept form

Answers

Answer 1

Answer:

y = 3x + 2

Step-by-step explanation:

y=mx+b is slope intercept form

to find slope (m):

y2-y1/x2-x1 = 11-8/3-2 = 3

your slope is 3 so 3x

to find the y-intercept (b):

plug in y and x from either of the two points

(2,8)... 8=3(2)+b and solve for b which equals 2

so final equation is y=3x+2


Related Questions

Charli bought 2 3/4 pounds of pears for 0.76 per pound and 2 3/4 pounds of grapes for 1.40 per pound. how much money in dollars and cents did charli pay for the pears and grapes?

Answers

Answer:

[tex]Total = \$5.94[/tex] ---- in dollars

[tex]Total = 594\ cents[/tex] ---- in cents

5 dollars 94 cents

Step-by-step explanation:

Given

Pears

[tex]Weight = 2\frac{3}{4}\ lb[/tex]

[tex]Amount = \$0.76[/tex] per pound

Grapes

[tex]Weight = 2\frac{3}{4}\ lb[/tex]

[tex]Amount = \$1.40[/tex] per pound

Required

Determine the amount paid for the fruit in dollar and cents

First, we need to calculate the amount paid for each fruit.

This is calculated by multiplying the amount per pound by the number of pounds bought.

For Pears:

[tex]Total_{Pears} = 2\frac{3}{4} * \$0.76[/tex]

Convert fraction to decimal

[tex]Total_{Pears} = 2.75 * \$0.76[/tex]

[tex]Total_{Pears} = \$2.09[/tex]

For Grapes

[tex]Total_{Grapes} = 2\frac{3}{4} * \$1.40[/tex]

Convert fraction to decimal

[tex]Total_{Grapes} = 2.75 * \$1.40[/tex]

[tex]Total_{Grapes} = \$3.85[/tex]

Next, we add both amounts together to get the total amount spent in dollars.

[tex]Total = Total_{Pears} + Total_{Grapes}[/tex]

[tex]Total = \$2.09 + \$3.85[/tex]

[tex]Total = \$5.94[/tex]

Multiply by 100 to convert this amount to cents

[tex]Total = 5.94 * 100\ cents[/tex]

[tex]Total = 594\ cents[/tex]

And it can be represented as dollars and cents as:

5 dollars 94 cents

What is 15 divided by 7.4?

Answers

The answer for that is 2.027

9×7=
9×70=
9×700=
9×7,000=
9×70,000=
9×700,000=
9×7,000,000=

Answers

63
630
6,300
63,000
630,000
6,300,000
63,000,000
9x7=63
9x70=630
9x700=6300
9x7000=63000
9x70000=630000
9x700000=6300000
9x7000000=63000000

Help please ... thanks

Answers

put the equation in desmos and you will get your answer :)
Start at point (0,-6) or start at the point that’s -6 on the y line. Then count up 9 the 1 to the right a place a point there. Finally connected ur two lines and that’s the line for your equation

If the x-values of the table shown above are doubled and the y-values stay the same, it represents the function g(x). Construct the equation for g(x)

Answers

Answer:

The maximum value of the table t(x) has a greater maximum value that the graph g(x)

Step-by-step explanation:

Hope this helps :P

hellpppppp please I will give brainliest​

Answers

Answer:

ITS THE 2ND ONE

Step-by-step explanation:

Answer:

y = 5/4x - 1

Step-by-step explanation:

if you look at the graph you will probably be able to tell

im not trying to be me if you think

1. A machine shop has eight screw machines but only three spaces available in the production area for the machine. In how many different ways can the eight machines be arranged in the three spaces available?
2. A quality control randomly selects two of five parts to test for defects. In a group of five parts, how many combinations of two parts can be selected?

Answers

Answer:

a= 336 different ways

b= 10 possible combinations

Step-by-step explanation:

As it is a definite machine and it must have ordered combinations therefore it is a permutation question . So finding 3 out of eight

8 P 3= 336  different ways the eight machines be arranged in the three spaces available.

Since the parts are randomly selected and there is no distinct pattern therefore combinations is used to solve this.

5C2 = 10 possible combinations of two parts can be selected.

I need an answer quick. I am trying to finish this fast.

Answers

Answer:

D, m<4 is 137°

Step-by-step explanation:

The answer would be D, because m<4 would be supplementary with the angle that's 43 degrees. Supplementary angles add up to 180, so this could be found through the following equation.

x + 43 = 180

x would represent <4

You would now subtract 43 from both sides.

x = 137

Answer:

D. The m<4 is 137°

Step-by-step explanation:

The rest of the angles are not correct because if you add 142+56 (adjacent angles) or the unknown angles (angle 1 + angle 2), it doesn't equal 180. You can picture it as angle 3 and its adjacent angle (56°) equal to 180 sience there sharing one straight line thus being 180°

List the transformations of the function
j(x) = 3(-7(x+2))-4

Answers

Answer:

transformations of function 3(-7(x+2))-4

vertical stretchhorizontal compressiontranslates lefttranslates downreflection across y-axis

5. Identify the type and subtype of each of the fol-

lowing problems.

a. Shawn has 15 marbles, which is 7 more mar-

bles than Kyle has. How many marbles does

Kyle have?

b. Tiffany has 12 blocks, 5 of which are cubes

and the rest cylinders. How many blocks are

cylinders?

c. Peter had some carrots. After he ate 3 of

them, he had 14 carrots left. How many car-

rots did Peter have before?

d. In a bag of 17 marbles, 9 marbles belong to

Kelly and the rest belong to Shauntay. How

many marbles belong to Shauntay?

Answers

Answer:

a) Kylie has 8 marbles

b) 7 Cylinders

c) 17 carrots

d) 8 marbles belong to Shauntay

Step-by-step explanation:

5. Identify the type and subtype of each of the fol-

lowing problems.

a. Shawn has 15 marbles, which is 7 more marbles than Kyle has. How many marbles does Kyle have?

Shawn = 15 marbles

S = K + 7

15 = K + 7

K = 15 - 7

K = 8 marbles

Kylie has 8 marbles

b. Tiffany has 12 blocks, 5 of which are cubes and the rest cylinders. How many blocks are cylinders?

T = 12 blocks

Cubes = 5

Cylinders = the rest

12 blocks = Cubes + Cylinders

Cylinders = 12 - Cubes

Cylinders = 12 - 5

Cylinder = 7

c. Peter had some carrots. After he ate 3 of them, he had 14 carrots left. How many carrots did Peter have before?

Number of carrots Peter has before

= Number of carrots he ate + Number of carrots he has now

= 14 + 3

= 17 carrots

d. In a bag of 17 marbles, 9 marbles belong to Kelly and the rest belong to Shauntay. How many marbles belong to Shauntay?

Total number of Marbles = 17

Kelly = 9 marbles

Shauntay = ?

Total = Kelly + Shauntay

Shauntay = Total - Kelly's marbles

= ( 17 - 9) marbles

= 8 marbles

8 marbles belong to Shauntay

Answer:

a) Kylie has 8 marbles

b) 7 Cylinders

c) 17 carrots

d) 8 marbles belong to Shauntay

Step-by-step explanation:

5. Identify the type and subtype of each of the fol-

lowing problems.

a. Shawn has 15 marbles, which is 7 more marbles than Kyle has. How many marbles does Kyle have?

Shawn = 15 marbles

S = K + 7

15 = K + 7

K = 15 - 7

K = 8 marbles

Kylie has 8 marbles

b. Tiffany has 12 blocks, 5 of which are cubes and the rest cylinders. How many blocks are cylinders?

T = 12 blocks

Cubes = 5

Cylinders = the rest

12 blocks = Cubes + Cylinders

Cylinders = 12 - Cubes

Cylinders = 12 - 5

Cylinder = 7

c. Peter had some carrots. After he ate 3 of them, he had 14 carrots left. How many carrots did Peter have before?

Number of carrots Peter has before

= Number of carrots he ate + Number of carrots he has now

= 14 + 3

= 17 carrots

d. In a bag of 17 marbles, 9 marbles belong to Kelly and the rest belong to Shauntay. How many marbles belong to Shauntay?

Total number of Marbles = 17

Kelly = 9 marbles

Shauntay = ?

Total = Kelly + Shauntay

Shauntay = Total - Kelly's marbles

= ( 17 - 9) marbles

= 8 marbles

8 marbles belong to Shauntaya) Kylie has 8 marbles

b) 7 Cylinders

c) 17 carrots

d) 8 marbles belong to Shauntay

Step-by-step explanation:

5. Identify the type and subtype of each of the fol-

lowing problems.

a. Shawn has 15 marbles, which is 7 more marbles than Kyle has. How many marbles does Kyle have?

Shawn = 15 marbles

S = K + 7

15 = K + 7

K = 15 - 7

K = 8 marbles

Kylie has 8 marbles

b. Tiffany has 12 blocks, 5 of which are cubes and the rest cylinders. How many blocks are cylinders?

T = 12 blocks

Cubes = 5

Cylinders = the rest

12 blocks = Cubes + Cylinders

Cylinders = 12 - Cubes

Cylinders = 12 - 5

Cylinder = 7

c. Peter had some carrots. After he ate 3 of them, he had 14 carrots left. How many carrots did Peter have before?

Number of carrots Peter has before

= Number of carrots he ate + Number of carrots he has now

= 14 + 3

= 17 carrots

d. In a bag of 17 marbles, 9 marbles belong to Kelly and the rest belong to Shauntay. How many marbles belong to Shauntay?

Total number of Marbles = 17

Kelly = 9 marbles

Shauntay = ?

Total = Kelly + Shauntay

Shauntay = Total - Kelly's marbles

= ( 17 - 9) marbles

= 8 marbles

8 marbles belong to Shauntay

Step-by-step explanation:

Nutted now I’m shaking

Answers

Answer:

Um... Ok..

Step-by-step explanation:

...

Man same lol
Sheesh
Except imma girl

How much does a 6-ounce apple weigh in grams?

I'll give brainiest

Answers

Answer:

169

Step-by-step explanation:

Find the dimensions of the right circular cylinder of maximum volume that can be placed inside of a sphere of radius R.

Answers

This question is incomplete, the complete question is;

Find the dimensions of the right circular cylinder of maximum volume that can be placed inside of a sphere of radius R(10cm)

What is the maximum volume?

Answer:

a) Dimensions of the cylinder are; Radius = 8.1650 cm , Height = 11.547 cm

b) the maximum volume is 2418 cm³

Step-by-step explanation:

From the image

radius of the sphere is 10cm

radius of the cylinder is x and its height is 2y

so

The volume of cylinder  is V = πr²h = πx²(2y)

Get V as function of just one variable x² + y² = 100

x² = 100 - y²

Therefore V = π( 100-y² )(2y) = 200πy-2πy³

V will be a maximum when V' = 0

V' = 200π - 6πy² =0

y² = 200π / 6π = 100/3

y = √(100/3) = 5.7735

x² = 100 - y²

x² =100 - (100/3)

x = √(200/3)

x = 8.1650

So The maximum volume will occur when the radius is 8.1650 cm

and the height 2y is 2(5.7735) = 11.547 cm

The maximum volume is

πr²h = π(8.1650)² (11.547 )  

= 2418 cm³

Therefore the maximum volume is 2418 cm³

!!!Plz help!!Choose the most appropriate name for the function described below.
The amount of bread depends on the amount of flour used to make it.
A. Flour(amount), or F(a)
B. Bread(flour), or B(0)
C. Flour(bread), or F(b)
D. Bread(amount), or B(a)

Answers

Answer:

Step-by-step explanation: The answer is Bread(flour) or b(f)

Could someone help a girl out?

Answers

Answer:

x = 19

Step-by-step explanation:

Trapezium area formula: [tex]\frac{a+b}{2} * h[/tex], where a & b are the two bases.

Now, if we plug in our known values, we can solve for the missing base.

[tex]\frac{5 + x}{2} * 4 = 48[/tex]

[tex]\frac{5 + x}{2} = 12\\\\5 + x = 24\\\\x = 19[/tex]

Answer:

Yes I would have to agree with Goliath, x = 19.

Step-by-step explanation:

You can mark Goliath Brainlest if you want they did the answer first.

20 points.Cynthia has a bag of jellybeans. There are two red jellybeans, one yellow jellybean, and two black jellybeans in her bag. Cynthia grabs two jellybeans and gives them to her friend, Pedro, and he eats them. What is the probability that she gives him two red jellybeans?

Answers

Answer:

1/10

Step-by-step explanation:

Cynthia has a bag of jellybeans.

There are two red jellybeans, one yellow jellybean, and two black jellybeans in her bag.

total no. of red jellybeans = 2

total no. of jellybeans = 20

Now,

2 ÷ 20 = 1/10

Thus, The probability that she gives him two red jellybeans is 1/10

Answer:

D. This is a dependent event because Pedro ate the jellybeans, and they cannot be replaced.

Step-by-step explanation:

Pretty much, dependent means it can’t be replaced and independent means it can be replaced.

A recipe calls for 2/3 cups of sugar. I have 5 1/2 cups of sugar. How many batches can I make, assuming I have a large quantity of all other ingredients?

Answers

Answer:

8.25 batches.

(Or, if rounding to the lowest amount of batches, 8 batches)

Step-by-step explanation:

We have in total 5 1/2 cups of sugar.

And the recipe calls for 2/3 cups of sugar.

So, to find out how many batches we can make, we can divide the amount of have by the amount needed. So:

[tex]5\frac{1}{2}\div\frac{2}{3}[/tex]

Let's convert the first fraction to improper form. We have 5 1/2. So, in improper form, it will be (5(2)+1)/2 or 11/2.

Therefore:

[tex]=\frac{11}{2}\div\frac{2}{3}[/tex]

To divide fractions, we keep, change, and flip. Therefore:

[tex]=\frac{11}{2}\times\frac{3}{2}[/tex]

Multiply straight across:

[tex]=\frac{33}{4}=8.25[/tex]

So, we can make 8.25 batches.

Or, we can make 8 full batches.

Ellen borrowed some money from her brother. She paid him back by giving him the same amount every week.The graph shows how much DO after each week.

A. 18 weeks
B.6 weeks
C.12 weeks
D. She will never pay it back

Answers

18 weeks will have to be do after each week
It’s 6 weeks

I’m 100% sure!

For f(x)=-5x+10, what is the value of x for which f(x) =35

X = 5
None are correct
X=3
X=-4
X=-5

Answers

Answer:

x=-5. -5x+10 replace the x with -5, multiply, add ten, and you'll get f(x)= 35

Answer:

-5

Step-by-step explanation:

f(x) =35

f(x) = -5x +10

equate the two equations:

-5x +10 =35

-5x =35-10

-5x =25

x = 25/-5

x = -5

h
– -1 = -3
6

what is the answer​

Answers

Answer:

-36

Step-by-step explanation:

Answer: -24

Explanation:

Which is a simplified form of the expression -6a + 2(2a + 2)?
A. -2a + 4
B. -2a – 4
C. 2a + 4
D. 2a – 4

Answers

Answer:

A.

Step-by-step explanation:

We have the expression:

[tex]-6a+2(2a+2)[/tex]

First, let’s distribute the 2 on the right:

[tex]=-6a+2(2a)+2(2)[/tex]

Multiply:

[tex]=-6a+4a+4[/tex]

Now, combine like terms:

[tex]=-2a+4[/tex]

Hence, our answer is A.

Answer:

a

Step-by-step explanation:

PLEASE HELP meeeeee asap

Answers

The answer is C

I’m 100% sure

Explanation:
If 3 is 56.5, then 4 would be:
180-56.5= 123.5

Since 3 and 4 are parallel to 7 and 8, they have the same angle sizes.

Therefore, angle 8 has the same answer as angle 4, which is 123.5. Answer is C.

Can you help me please and thank you

Answers

Answer:

I believe the answers in the blank should be 4

Step-by-step explanation:

Answer:

= (4 x 5) + (4 x 2)

Step-by-step explanation:

remember to multiply first, before doing the addition. in this case, multiply 4 by 5, then 4 by 2 to get your answer using distributive property. i always remember the distributive process because if you take off a few letters, it makes distribute. you basically distribute 4, you give each number (5 and 2) a 4 and multiply them. hope this made sense lol

Substitution
2x-y=7
3x-2y=10

Answers

Answer:

x=4

y=1

Step-by-step explanation:

Solve for x: (5 points)

negative 4 over 3, multiplied by x minus 6 equals negative 26

a
−27

b
−15

c
15

d
27

Answers

Answer:

the problem is like that or is showing u how are the equations ?

In timed pls help

To find this product, Julissa first multiplied 83 x 49.

0.83 x 0.49 = 4067

Where should she place a decimal point in the final product

O Before the 4

O after the 4

O after the 0

O before the 7

Answers

She would place it before the 4.

Answer:

that guys answer is right thx and have a god day :)

Step-by-step explanation:

Solve these inequalities:
7x-1<26-2x
please help me with this one guys ;-;

Answers

Answer:  inequality form x < 3    interval form: ( -∞, 3)

Step-by-step explanation:

Isolate the variable by dividing each side by factors that don't contain the variable.

Solve the equation for m. 7(m+5)=21 m = -2 m = 2 = m= 9​

Answers

Answer:

I'm thinking it's 9

Step-by-step explanation:

what is the slopeof the function x=(-4) y=(-2)

Answers

Answer: The answer is -4. Hope this helps!

Fill in the table using this function rule.
y=-3x + 5

Answers

Answer:

y=-3(-4)+5,,,, you get y=12+5  y=17

y=-3(-2)+5,,,, you get y=6+5  y=11

y=-3(0)+5,,,, you get y=0+5  y=5

y=-3(2)+5,,,, you get y=-6+5 y=-1

Step-by-step explanation:

hope it helps:)
Other Questions
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns what is the range and domain of this question? im unsure A 45 kg object has a momentum of 225 kg-m/s northward. What is the object's velocity?A. 180 m/sB. 5.0 m/sC. 10,125 m/sD. 0.20 m/s Mrs. Chin paid a 20 percent tip on the bill for lunch.PercentsTotal20%20%20%20%20%100%$2.75$2.75$2.75$2.75$2.75If the tip amount was $2.75, what was the bill for lunch before the tip was added to it?$5.50$13.75$16.50$55.00 4n-(7-6n)Helppp plz Leia just read that the national debt owed by the federal government is at an all-time high. (Explain any possible impact on the federal government from unexpected inflation.) What is the mass of HF produced by three reaction of 3.0 10 to the 23 molecules of H2 with excess F2 Please help this one is also due tomorrow Lydia buys 5 pounds of apples and 3 pounds of bananas for a total of $8.50. Ari buys 3 pounds of apples and 2 pounds of bananas for a total of $5.25. Determine a system of equations that represents the given the situation. Let x be cost per pound of apples and let y be the cost per pound of bananas. Which equation represents the amount of money Lydia spent of apples and bananas? Which equation represents the amount of money Ari spent on apples and bananas? Choose the word or phrase that best completes each sentence. prepared the body for its journey to the afterlife.The were constructed as tombs for the pharaohs and their relatives.Tutankhamen's tomb was an important archaeological find because it was the only ever found. Ratios. May someone help me, also may you please add the explanation. question one : when two plates converge, they are what?a) moving away from each otherb) moving towards each otherc) sliding along each otherd) colliding with each otherquestion two : when two plates converge, they are what?a) moving away from each otherb) moving towards each otherc) sliding along each otherd) moving towards, then moving away from each otherquestion three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?a) the rocks are youngest the further away you move from the ridgeb) the rocks are oldest the further away you move from the ridgec) the rocks are the same age no matter how far away from the ridge you moved) the rocks do not age invisible force, What is most likely the meaning of the word hypothesi. O foolishly believed thoughtfully guessed O already knew o boldly proclaimed 2 3 In XYZ the sides YZ = x, XZ = y, and YZ = z, and x>y>z. Which angle of the triangle can have measure of 60?