x²+1=2x
hope someone can help thanks!​

Answers

Answer 1

Answer:

I think it’s x=1

Answer 2

Answer:

Step-by-step explanation:

x^2 + 1 = 2x

x^2 - 2x + 1 = 0

Factor (x - 1) ( x - 1)

x = 1


Related Questions

In a litter of 7 kittens, each kitten weighs less than 3.5 ounces. Find and graph all the possible combined weights of the kittens.

Answers

Answer:

Step-by-step explanation:

24.5 just multiply hope that helpss

Which is an equivalent ratio of yellow cans to blue cans?

10:12

30:25

18:16

5:6

Answers

Answer: 30:25

Step-by-step explanation:

notice how there are 6 yellow and 5 blue

so if we multiply both by 5 then we get

30:25

30:25 because there’s 6 blue cans and 5 yellow cans which means that you do 6x5 and 5x5

Find the product of 6b(2 over 3b).

20 over 3b
4b
23 over 3 b2
4b2

Answers

Answer:

c is my opinion

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

trust me.

Is the following double number line drawn correctly? Use complete sentences to explain your reasoning.

Answers

The double number line is not correctly drawn because the second line shows numbers that do not follow a sequence.

What is a double number line?

A double number line is a type of graph that displays two lines each with numbers that follow a sequence. Moreover, it is expected the numbers in one line are equivalent to the numbers on the other line.

For example, the top line can show the weight in grams, while the bottom line shows the weight in kilos.

Is the double number line correct?

This double number line is not correct because the second line has numbers that do not a follow a sequence, the correct sequence would be:

0, 4, 8, 12 (multiples of 4), which means 3 does not match.

Learn more about sequences in: https://brainly.com/question/21961097

#SPJ1

Answer:The double number line is not correctly drawn because the second line shows numbers that do not follow a sequence.

What is a double number line?

A double number line is a type of graph that displays two lines each with numbers that follow a sequence. Moreover, it is expected the numbers in one line are equivalent to the numbers on the other line.

For example, the top line can show the weight in grams, while the bottom line shows the weight in kilos.

Is the double number line correct?

This double number line is not correct because the second line has numbers that do not a follow a sequence, the correct sequence would be:

0, 4, 8, 12 (multiples of 4), which means 3 does not match.

What is the volume of a sphere with a radius of 9 units?
O A. 97271 units3
O B. 2437 units3
O C. 4867 units
O D. 32477 units3

Answers

Yes it would be 3,053.63 units^3.

But in our case, from the choices above, it would be (A. 972 pie units^3)

hope this helps.

Step-by-step explanation:

The volume of a sphere with a radius of 9 units is,

⇒ Volume of sphere = 339.12 units³

What is Multiplication?

To multiply means to add a number to itself a particular number of times. Multiplication can be viewed as a process of repeated addition.

Given that;

Radius of sphere = 9 units

Now, We know that;

Volume of sphere = 4/3 πr²

Radius = 9 units

Hence, We get;

⇒ Volume of sphere = 4/3 πr²

⇒ Volume of sphere = 4/3 × 3.14 × (9)²

⇒ Volume of sphere = 339.12 units³

Thus, The volume of a sphere with a radius of 9 units is,

⇒ Volume of sphere = 339.12 units³

Learn more about the multiplication visit:

https://brainly.com/question/10873737

#SPJ7

When is christmas 2021

Answers

Answer:

IN 15 days

Step-by-step explanation:

EASY

MARK AS BRAINLIEST

Answer:

in december 23-24

Step-by-step explanation:

i gueess

Which expression finds the measure of an angle that is coterminal with a 45° angle? 45° 90° 45° 180° 45° 270° 45° 360°.

Answers

The measure of an angle is the coterminal angle with a 45A°+360A° and can be determined by using the measurement of coterminal angles.

We have to determine

Which expression finds the measure of an angle that is coterminal with a 45° angle?

According to the question,

Coterminal angles are those angles that share the terminal side of an angle occupying the standard position.

The standard position means that one side of the angle is fixed along the positive x-axis, and the vertex is located at the origin.

A coterminal with 45° is 45°+k°360° with k as an integer.

Then,

The coterminal angle with 45°,

When k = 0

Then,

[tex]\rm = 45+(0)360\\\\= 45+0\\\\= 45 \ degree[/tex]

When k = 1

Then,

[tex]\rm = 45+(1)360\\\\= 45+360\\\\= 405 \ degree[/tex]

When k = -1

Then,

[tex]\rm = 45+(-1)360\\\\= 45-360\\\\= -315 \ degree[/tex]

Hence, The measure of an angle that is coterminal with a 45A°+360A°.

For more details about the Coterminal angle refer to the link given below.

https://brainly.com/question/12378421

What is the equation of the line that is perpendicular to line m and passes through the point (3, 2)?

Answers

Answer:

y = [tex]\frac{2}{5}[/tex] x + [tex]\frac{4}{5}[/tex]

Step-by-step explanation:

Calculate the slope of line m using the slope formula

m = [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex]

with (x₁, y₁ ) = (- 2, 2) and (x₂, y₂ ) = (0, - 3) ← 2 points on the line

m = [tex]\frac{-3-2}{0-(-2)}[/tex] = [tex]\frac{-5}{0+2}[/tex] = - [tex]\frac{5}{2}[/tex]

Given a line with slope m then the slope of a line perpendicular to it is

[tex]m_{perpendicular}[/tex] = - [tex]\frac{1}{m}[/tex] = - [tex]\frac{1}{-\frac{5}{2} }[/tex] = [tex]\frac{2}{5}[/tex] , then

y = [tex]\frac{2}{5}[/tex] x + c ← is the partial equation in slope- intercept form

To find c substitute (3, 2 ) into the partial equation

2 = [tex]\frac{6}{5}[/tex] + c ⇒ c = 2 - [tex]\frac{6}{5}[/tex] = [tex]\frac{4}{5}[/tex]

y = [tex]\frac{2}{5}[/tex] x + [tex]\frac{4}{5}[/tex] ← equation of perpendicular line

4/9 + 9/18. Please help me as soon as possible, it's due today.

Answers

Answer:

[tex]\frac{17}{18}[/tex]

Step-by-step explanation:

To solve 4/9 + 9/18 just find the common denominator which is 18.

to get 4/9 to get the denominator of 18 you multiply the denominator by 2:

9 x 2 = 18, what you do to the bottom you do to the top (Multiply the numerator by 2 also) so, 4 x 2 = 8.

Now, add the numerator and keep the denominator the same. 8 + 9 = 17.

8/18 + 9/18 = 17/18

Troy has 5/6 ounces of sprinkles to make cupcakes. The recipe uses 1/4 ounce per dozen of cupcakes. Write an expression which can be used to determine how many dozens of cupcakes Troy can make.

Help please? :)​

Answers

Answer:

[tex]\frac{\frac{1}{4}}{1}=\frac{\frac{5}{6}}{x}[/tex]

Step-by-step explanation:

Per = 1

[tex]\frac{1}{4}[/tex]

So, if we were to solve:

[tex]\frac{1}{4}=\frac{5}{6x}[/tex]

[tex]\frac{1}{4}\cdot \:6x=1\cdot \:5[/tex]

[tex]\frac{3}{2}x=5[/tex]

[tex]\frac{3}{2}x\cdot \:2=5\cdot \:2[/tex]

[tex]3x=10[/tex]

[tex]\frac{3x}{3}=\frac{10}{3}[/tex]

[tex]x=\frac{10}{3}[/tex]

Troy can make [tex]\frac{10}{3}[/tex] dozen of cupcakes.


Part B
If a company was charged $16.25 to deliver sneakers, what was the distance of the delivery ride?
Show work that supports your answer. (2 points)
Part A: Write the function rule (equation) for describing the total rate y as a
function of the total miles x.*
What is the answer

Answers

Answer:

Step-by-step explanation:

Part A:

y=1.5x+4.25

Part B:

16.25=1.5x+4.25

Minus 4.25 from both sides

12=1.5x

Divide both sides by 1.5 and you will get x=8

what the sum of 9999x23

Answers

Answer:

suma is 229,997

Step-by-step explanation:

229,997

find the some of -3x^2-x-10 and 10x^2+x-10

Answers

Add likewise terms together (add the coefficients of x^2 together, same with just x, etc)

10x^2 – 3x^2 = 7x^2

1x – 1x = 0

– 10 – 10 = –20

So the answer is 7x^2 – 20.

Answer:

( X - 2 )(3x + 5)  For 3x^2-x-10

Step-by-step explanation:


What is the height of the triangle?
17 units
34 units
51 units
68 units

Answers

51 units
Using right triangle formula we will get 51 explanation in the picture

mori has 6 7/10 pounds of potatoes. she uses some of the potatoes in a salad. now she has 2 2/5 pounds of potatoes left. How many pounds did maori use?

Answers

Answer:

43/10 pounds = 4 3/10 pounds

Step-by-step explanation:

for this you want to subtract 6 7/10 minus 2 2/5. You first have to get a common denominator and find the numerator then subtract.

Hs math need help on triangle

A 100 , 100 , 160

B 100 , 100 , 100

C 100 , 60 , 20

D 100 , 40 , 40

Answers

Answer:

Option D.

Step-by-step explanation:

It must be option D because an isosceles triangle always have two angles the same measure and must be a total of 180°.

Hoped this helped.

[tex]BrainiacUser1357[/tex]

Let other two angles be x

[tex]\\ \tt\Rrightarrow x+x+100=180[/tex]

[tex]\\ \tt\Rrightarrow 2x+100=180[/tex]

[tex]\\ \tt\Rrightarrow 2x=80[/tex]

[tex]\\ \tt\Rrightarrow x=40[/tex]

Option D is correct

Research suggests that high school students could benefit from later school starting times. A school administrative team is considering a proposal to move the starting time of the local high school one hour later than the current start time. To measure interest in the proposal, members of the team randomly select subjects attending a large soccer tournament played on the high school grounds on a Saturday morning. The team finds that 58% of those surveyed support a later high school start time. Which type of bias is most likely to be present in the survey results?

This is undercoverage bias because adults with children are more likely to be included in the sample.
This is question wording bias because the phrasing of the later start times question may be confusing to some subjects.
This is nonresponse bias because some of those selected may choose to not provide their opinion on later start times.
This is voluntary response bias because vocal supporters of later start times will be more likely to offer their opinion.

Answers

Answer:

This is voluntary response bias because vocal supporters of later start times will be more likely to offer their opinion.

Step-by-step explanation:

Answer:

undercoverage bias

Step-by-step explanation:

I need help plz asp

Answers

9

Step-by-step explanation:

woody is 5

buzz is 3

mr potato head is 3

rex is 7

alien is 1

I need help on this. I've no idea about this. Please help me...​

Answers

Answer:

Answers are below.

Step-by-step explanation:

Hope this helps:)

if a = 3y + 4z and b = z - 2y, then what is the value of a + b?

Answers

Answer:

y + 5z

Step-by-step explanation:

Hope this helps!

Simplify (45)-(+14). Pls guys explain it to me

Answers

Answer:

Answer: 31

Step-by-step explanation:

[tex]{ \rm{45 - ( {}^{ + } 14)}} \\ \\ = { \rm{45 - 14}} \\ \\ = { \rm{31}}[/tex]

Answer:

31

Step-by-step explanation:

(45)-(+14)

This is asking us to take 45 [(45)] and subtract 14 [-(+14)]

That is 45 - 14 = 31

The expression "-(+14)" is a deliberate attempt to confuse.  It says "subtract a positive 14."  There was no need to add the "+" sign in the parentheses, since a positive value is always assumed.  But it was added here to promote heartburn and the sale of TUMS.  When I see something like "-(+10000)," I immediately change it to "-10000" and move on, adding one demerit to the author of the problem.

Can someone please take the time out of day to help me with this

Answers

Answer:

a. 54, b. 117, c. 63

Step-by-step explanation:

a. Angle 11 is corresponding to angle 1, which is linear to angle 2, which is 126 degrees. So angle 11 is 180 - 126 = 54 degrees

b. Angle 8 corresponds to angle 14, which is 117 degrees.

c. Angle 7 is linear to angle 8, so it is 180 - 117 = 63 degrees

Answer:

a or <11 is 54 degrees, b or <8 is 117 degrees, c or <7 is 63 degrees

Step-by-step explanation:

A. <2 = <12, <12 + <11 = 180, 180 - 126 = 54

B. <14 = <8, 117 = 117

C. <7 + <8 = 180, 180 - 117 = 63

Solve the inequality

4x - 19 ≥ -27

Answers

The answer is X>-2. I uploaded a picture of the steps below. Hope this helps. :)

6. Line a: y - 3x = 4
Line b: y = 3x + 5
Line c: y - 4x = 3

Which lines are parallel

Answers

Answer:

Line a and b

Step-by-step explanation:

PLEASEEE HURRY. Please I really need this please

Answers

Answer:

answer is

Step-by-step explanation:

Answer:

final answer is: ABC, A (-5,1), B (-4,6) and C (-1,4)

Step-by-step explanation:

Original: ABC, A (2,-1), B (1,4) and C (-2,2)

translate 3 units to the right and 2 units up: ABC, A (5,1), B (4,6) and C (1,4)

reflected over the x-axis: ABC, A (5,-1), B (4,-6) and C (1,-4)

rotated 180°: ABC, A (-5,1), B (-4,6) and C (-1,4)

What is the LCM of 8 and 10

Answers

40


8x5=40
10x4=40

Hope this helps

A. -78
B. 49
C. 53
D. 14

Answers

Answer: 49

Step-by-step explanation:

Which point is the circumcenter of the triangle?

Answers

Answer:

it is D

Step-by-step explanation:

For knowing it, it is necessary to draw straight line above the triangle from the middle of the sides, forming a 90° degree angle. But as they are already drew, it is easier

Given ΔABC with points A, B and C on the circle, the circumcenter of the triangle is point D.

Circumcenter of a circle is the point where the perpendicular bisectors on the sides of the triangle, whose vertices touch the circumference of the circle, intersect.

Perpendicular bisector of a line segment is another line segment which makes an angle of 90 degrees with it and divide the line segment into two equal parts.

In the given figure, we have triangle ABC.

A, B and C vertices touch the circle.

We need to find the circumcenter of the circle.

The sides of the triangle ABC are AB, BC and AC.

The perpendicular bisectors of the sides AB, BC and AC are ED, GD and FD respectively. We can verify so from the figure.

The point where the three perpendicular bisectors meet is the point D, again from the figure, thus, clearly point D is the circumcenter of the triangle.

Learn more about circumcenter here

https://brainly.com/question/29927003

#SPJ2

Brainliest
Please do one of the above
(I would appreciate if you did more then one)

Answers

Answer:

a) 52.5 ft. b)40.1ft c)12.5ft d) 72.6

Step-by-step explanation:

a) The height of the lighthouse is 84ft, and the angle of elevation is 58 degrees.

tan58=84/x

find x by dividing 84 by tan58, and you get 52.5ft.

b) do the same thing, except 131 is in the base of the right triangle shape. That being said, do tan17=x/131.

multiply 131 by tan17, and you get x=40.1 feet.

c) This question wants you to find the length of the slide, (basically the hypotenuse).

given the angle to be 46, do sin46=9/x

since sin is opp/hyp

9/sin46= 12.5ft

d) Find the angle of elevation by using inverse tan given the base to be 5, and the height to be 16ft.

tan^-1=(16/5)=theta

x=72.6 hope this helps!

Answer:

Step-by-step explanation:

The temperature dropped 4 1/2 degrees each hour for 5 hours. By how many degrees did the temperature fall during those five hours?

Answers

Answer:

22.5

Step-by-step explanation:

You take the unit rate and multiple that by how many hours are going by. 4.5x5

Other Questions
how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please You are pulling a child in a wagon. The rope handle is inclined upward at a 60 angle. The tension in the handle is 20 N.Part AHow much work does the rope do on the wagon if you pull the wagon 200 m at a constant speed? how to solve the following system y=(1/2)x^2+2x-1 and 3x-y=1 1. All the computer has a power button. Use the function below to find f(-2).f(x) = 5xO A. -25O B. 1/10O c. 1/25O D. -10 What is [tex]rs^{3}[/tex] divided by 8-2r if r=8 and s=3? A triangle has side lengths of 2 feet, 5.4 feet, and 5 feet. The angle measures are 90 degrees, 73 degrees, 17 degrees. Another triangle has side lengths of 3 feet, 8.1 feet, 7.5 feet. The angle measures are 90 degrees, 73 degrees, 17 degrees. Are the triangles similar? If so, what is the scale factor going from the top triangle to the bottom triangle? A 9-foot roll of waxed paper costs $4.32. What is the price per inch? What role did Thomas Catron play in women's suffrage in New Mexico?A.He steadfastly opposed women's suffrage. B.He did not take a stand for it or against it. C.He steadfastly supported women's suffrage. D.None of the above are true about Thomas Catron.