y is inversely proportional to the square root of x. y=5 when x=36. find a formula linking x and y.​

Answers

Answer 1

Answer:

y = 30/√x

Step-by-step explanation:

y = k/√x (where k is a constant).

5 = k/√36

5 = k/6

5 X 6 = k

k = 5 X 6 = 30.

y = 30/√x


Related Questions

Is a triangle with side lengths 21,20 and 29 a right triangle show why or why not .

Answers

Step-by-step explanation:

Yes, we can determine whether a triangle is a right triangle or not by using the Pythagorean Theorem, which states that in a right triangle, the square of the length of the hypotenuse (longest side) is equal to the sum of the squares of the other two sides.

Let's label the sides of the triangle as follows: side a = 21, side b = 20, and side c = 29 (where c represents the hypotenuse). Now, we can use the Pythagorean Theorem to check whether the triangle is a right triangle or not:

c^2 = a^2 + b^2

Substituting in the given values, we get:

29^2 = 21^2 + 20^2

841 = 441 + 400

841 = 841

As the equation is true, we can conclude that the triangle is a right triangle.

no because a right triangle must be 90 degrees

An arctic ecologist measures the thickness of an ice floe. The thickness is 0.039 m. What is the thickness in centimeters? Write your answer as a decimal.

Answers

The thickness of the ice floe is 3.9 centimeters.

Given that an ice floe's thickness is measured by an arctic ecologist. It measures 0.039 m thick.

We need to determine the thickness in centimeters,

Using the concept of unit conversion,

Since there are 100 centimeters in a meters, you must multiply the figure by 100 to convert from meters to centimeters.

The ice floe's thickness is 0.039 m, which may be converted to centimeters as follows:

100 cm/m times 0.039 m equals 3.9 cm.

The ice floe is 3.9 centimeters thick as a result.

Hence the thickness of the ice floe is 3.9 centimeters.

Learn more about unit conversion, click;

https://brainly.com/question/28600662

#SPJ1

a is a negative odd number.
Choose two words from the list in the box that describe a²
A negative
B positive
Codd
D even

Answers

Answer:

positive and odd

Step-by-step explanation:

If a is a negative odd number, then a² can't be negative, because a number squared is always positive.

I'll illustrate this with an example.

Let's choose -7 as an example. Instead of a.

-7² = 49

So we see that the result is positive & odd.

So the words that describe a^2 are positive and odd.

Question 1 of 10 Solve - 5 < 4x + 3 <= 7 x > - 2orx <= 1 B. x < - 2orx < 4 O C.-2 and x <= 1 D. x > 2 and x < 4

Answers

For the inequality  -5 < 4x + 3 ≤ 7 the  combined solution are x < -2 and x ≤ 1.

To solve the inequality -5 < 4x + 3 ≤ 7, we need to consider two separate inequalities:

Solve the inequality -5 < 4x + 3:

-5 < 4x + 3

Subtract 3 from both sides:

-5 - 3 < 4x

-8 < 4x

Divide both sides by 4

-8/4 > x

-2 > x

x < -2.

Now let's solve the inequality 4x + 3 ≤ 7:

4x + 3 ≤ 7

Subtract 3 from both sides:

4x ≤ 7 - 3

4x ≤ 4

Divide both sides by 4:

x ≤ 1

Therefore, the combined solution is x < -2 and x ≤ 1.

To learn more on Inequality click:

https://brainly.com/question/28823603

#SPJ1

A jar has dimes and nickels. The number of dimes is four less than seven times the number of nickels. Let n represent the number of nickels. Write an expression for the number of dimes.

Answers

Answer:

d = 7n -4

Step-by-step explanation:

d is number of dimes, n is number of nickels.

7 X number of nickels = 7n.

4 less than that is 7n - 4.

so d = 7n -4.

Find the missing coordinate in the ordered pair ( -1 , b )
if it is a solution to the equation 5x-3y=10
a -7
b-5
c-4
d 4
e o
.

Answers

Answer:

To find the missing coordinate in the ordered pair (-1, b), we can substitute the value of x into the equation 5x-3y=10. This gives us 5(-1)-3y=10. Solving for y, we get -5-3y=10, -3y=15, and y=-5. Therefore, the missing coordinate in the ordered pair (-1, b) is -5. The correct answer is b) -5.

The point F( – 3, – 6) is translated 4 units right and 2 units up. What are the coordinates of the resulting point, F

Answers

Answer:The answer is (1, -4)

Step-by-step explanation:

the length of arc AB is 6pi and the measure of arc AB=60 degrees. What is the diameter of the circle?

Answers

Answer:

36

Step-by-step explanation:

Arc = rad * radius
radius = arc/rad
given, arc = 6π
rad = 60 * π/180 = π/3 rad
radius = 6π / (π/3)
= 6π * 3/π
= 18
Diameter = 2 * radius
= 2*18
= 36

what is the following term of -3;0;3;6.​

Answers

Step-by-step explanation:

Start at -3    then begin adding 3's to get the next terms

-3   0    3    6    9  .....

The next term in the sequence would be 9.

What is true about the graph below? Select SIX TRUE statements

Select ALL TRUE statements
A) There are no zeroes
B) There is one zero
C) There are two zeroes
D) The vertex is (1, 14)
E) The vertex is (14, 1)
F) The vertex is (2, 14)
G) The vertex is (14, 2)
H) The axis of symmetry is x = 1
I) The axis of symmetry is x = 2
J) The "a" of the parabola is positive
K) The "a" of the parabola is negative
M) The parabola has a minimum
N) The parabola has a maximum
O) The zeroes are -2 and 6
P) The zeroes are 1 and 6
Q) The zero is 6
R) The zero is 14

Answers

Step-by-step explanation:

Remember that, this is quadratic function graph.

Let's analyze fact the graph. We get :

There are two roots/zeroes Two roots are x1 = -2 , x2 = 6Vertex is maximum value of parabola (2,14)Symmetry function is x = 2 (you can show that, x-axis from vertex)"a" parabola indicated negativeThe parabola with "a" negative, thus have maximum value (show that vertex is (2,14))

Conclusion :

The true statements are C,F,I,K,N,O (6 statements are shown)

Subject : Mathematics

Level : JHS

Chapter : Quadratic Functions

Bromine-82 has a half-life of about 35 hours.

After 140 hours, how many milliliters of an 80 mL sample will remain?

65 mL
20 mL
10 mL
5 mL

Answers

Answer:

[tex]\huge\boxed{\sf 5 \ mL}[/tex]

Step-by-step explanation:

Amount of Br-82 = 80 mL

Half-life = 35 hours

Total time = 140 hours

No. of half lives spent:

= Total time / Half-life

= 140 / 35

= 4 half lives

After 1st half life:

= 80 / 2

= 40 mL

After 2nd half life:

= 40 / 2

= 20 mL

After 3rd half life:

= 20 / 2

= 10 mL

After 4th half life:

= 10 / 2

= 5 mL

[tex]\rule[225]{225}{2}[/tex]

Can anyone help me solve this question?
x = e^y

Answers

Step-by-step explanation:

Pick any point on the graph below for a solution:

can I get some help with finding this volume

Answers

Answer: 216 cm³

Step-by-step explanation:

>Break the shape up into 2 separate shapes so we can work with shapes we know (rectangular prisms/ blocks)

>Let's call the bottom left small block, Shape 1

>Let's call the bigger block on right, Shape 2

Volume for rectangular prism = Length x width x height

Shape 1:

length = 4

width = (6-4) =2

height = (12-9) = 3

V = (4)(2)(3) =24

Shape 2:

length= 4

width = 4

height = 12

V= (4)(4)(12)

V=192

Total volume = 24+192 =216 cm³

What would be the Prefix notation for the given equation?

(a+(b/c)*(d^e)-f)


a.
-+a*b/c^def


b.
-a+*/bc^def


c.
-+a*/^bcdef


d.
-+a*/bc^def

Answers

The Prefix notation for the given equation is "[tex]\pm a \times /bc^{de}^f[/tex]". d.

The Prefix notation for the given equation "[tex](a+(b/c) \times (d^e)-f)[/tex]" would be:

[tex]\pm a \times /bc^{de}^f[/tex]

In Prefix notation, also known as Polish notation, the operators come before their operands.

Here's a step-by-step breakdown of converting the given equation to Prefix notation:

Start with the given equation: (a+(b/c)*(d^e)-f)

Replace the arithmetic operators with their corresponding symbols in Prefix notation:

Addition (+) becomes +

Division (/) becomes /

Exponentiation (^) becomes ^

Subtraction (-) becomes -

Rearrange the equation to move the operators before their operands:

Replace [tex](a+(b/c)(d^e)-f)[/tex] with [tex](\pm a/bc^{de}^f)[/tex]

For similar questions on Prefix notation

https://brainly.com/question/12977982

SPJ11

The picture of milk shown is a prism. The base has an area of 40 cm² and the height of the pitcher is
26 cm. Will the pitcher hold 1 Liter of milk?

Answers

Yes, the pitcher hold 1 Liter of milk.

We have to given that;

The picture of milk is a prism.

And, The base has an area of 40 cm² and the height of the pitcher is 26 cm.

Since, We know that;

Volume of prism is,

V = base area x Height

Now, Substitute all the values, we get;

V = 40 x 26

V = 1040 cm³

Since, 1 liter = 1000 cubic centimeters

Hence, the pitcher hold 1 Liter of milk.

To learn more about the volume visit:

brainly.com/question/24372707

#SPJ1

Anuj made a cuboid of dough of dimensions 5 cm, 5 cm and 3 cm. How many such cuboids will he need to make a perfect cube? What will be the dimensions of the cube?​

Answers

Answer:

Step-by-step explanation:Anuj made a cuboid of dough of dimensions 5 cm, 5 cm and 3 cm. How many such cuboids will he need to make a perfect cube? What will be the dimensions of the cube?​

¿Cuál es el volumen, en metros cúbicos, de un prisma rectangular con una altura de
17 m, un ancho de 14 m y una longitud de 11 m?

Answers

Answer:

V = 2618 cubic meters

Step-by-step explanation:

multiply the three dimensions to obtain volume

(17)(14)(11) = 2618 m3

Hope this helps

Kathy had of a pepperoni pizza in
her refrigerator. She gave her friend
a slice that was of the original pizza.
How much pizza does Kathy have left?

Answers

The answer is she has 7/8 (or seven slices) of the pizza left. Based on the information given, we can calculate that Kathy ate 1/8 (or one slice) of the original pepperoni pizza.  

It is important to note that the size of the original pizza is unknown, so we cannot accurately determine the exact amount of pizza Kathy has left in terms of square inches or centimeters.

However, we do know that she has the majority of the pizza remaining, and could potentially have enough for multiple meals or leftovers. Additionally, if Kathy is tracking her caloric intake, she can calculate the number of calories consumed from the slice she ate and adjust her diet accordingly.

Overall, it seems like Kathy has a decent amount of pizza left to enjoy

To learn more about : calculate

https://brainly.com/question/17145398

#SPJ11

The number 84 can be expressed as the sum of 54 + 30. Which shows how to use the distributive property to rewrite that sum as a multiple of a sum whose addends have no common factors greater than 1?
A. 2(27 + 15)
B. 3(18 + 10)
C. 5(11 + 6)
D. 6(9 + 5)

Answers

The answer of the sum is D. 6(9 + 5).

To rewrite the sum 54 + 30 using the distributive property as a multiple of a sum whose addends have no common factors greater than 1, we need to factor out the greatest common factor from both numbers.

The greatest common factor of 54 and 30 is 6. By factoring out 6, we can rewrite the sum as:

54 + 30 = 6 * (9 + 5)

Now, let's examine the options given:

A. 2(27 + 15) does not have a common factor of 6.

B. 3(18 + 10) does not have a common factor of 6.

C. 5(11 + 6) does not have a common factor of 6.

D. 6(9 + 5) is the correct answer because it has a common factor of 6, which is the greatest common factor of 54 and 30.

Therefore, the answer is D. 6(9 + 5).

For more questions on sum

https://brainly.com/question/28546814

#SPJ11

Compute the MIRR statistic for Project J and advise whether to accept or reject the project with the cash flows shown as follows if the
appropriate cost of capital is 10 percent.
Project J
Time
Cash Flow
e
1,000
1
$300
2
$1,480
3
500 $300
Save & Exit
5
100
Submit

Answers

To compute the Modified Internal Rate of Return (MIRR) for Project J, we need to calculate the present value of cash inflows and outflows separately and then determine the discount rate that equates the present value of outflows with the future value of inflows.

The cash flows for Project J are as follows:

Time 0: Initial investment: -$1,000

Time 1: Cash inflow: $300

Time 2: Cash inflow: $1,480

Time 3: Cash inflow: $500

Time 5: Cash inflow: $100

First, let's calculate the present value (PV) of outflows (the initial investment):

PV(outflows) = -$1,000 (since it's an outflow at time 0)

Next, let's calculate the future value (FV) of inflows (cash inflows at times 1, 2, 3, and 5):

FV(inflows) = $300 + $1,480 + $500 + $100 = $2,380

Now, we can use the MIRR formula to compute the MIRR statistic:

MIRR = (FV(inflows) / PV(outflows))^(1/n) - 1

Where n is the number of periods (5 in this case).

MIRR = ($2,380 / -$1,000)^(1/5) - 1

MIRR = 1.5189 - 1

MIRR = 0.5189 or 51.89%

Given that the cost of capital is 10 percent, the MIRR is higher than the cost of capital. Therefore, we would advise accepting Project J because the MIRR is greater than the cost of capital, indicating that the project is expected to generate a return higher than the required rate of return.

A 500g packet of beans costs £1.55. A 125g packet of the same beans costs £0.36. Which packet is better value for money?

Answers

Step-by-step explanation:

Find unit cost per gram for each packet....lower unit cost is better value

L 1.55 / 500 g = .0031   L/g

L .36 / 125 g    = .0029  L/g     <=======best value 125 g packet

5.
Find the surface area and volume of the
right cylinder. Round your answer to the
nearest hundredth.
22 m
20.4 cm

Answers

Step-by-step explanation:

consider the cylinder standing upright.

we have to assume that 20.4 cm is the diameter of the circle.

it is not clear what dimension of the result is needed : cm³ or m³, cm² or m². it is important that we do our calculations always with the same dimension of all operands (don't mix apples and oranges in the same calculation).

the volume of such a cylinder (or any regular 3D object) is

base area × height

for a cylinder the base area is a circle :

pi × r²

r being the radius (half of the diameter).

so, we have

r = 20.4/2 = 10.2 cm

height = 22 m = 2,200 cm (1 m = 100 cm)

volume = pi × (10.2)² × 2200 =

= 719,072.8593... cm³ =

= 0.7190728593... m³

≈ 719,072.86 cm³

≈ 0.72 m³

for the surface of a cylinder we need to imagine to cut the cylinder open with straight cut from the top to the bottom and then put the result flat on the table.

this result is a rectangle.

length = height of the original cylinder.

width = circumference of the original cylinder (and its circular base) = 2 × pi × r

the surface area of the cylinder is then

2 × base circle area (top and bottom) = 2 × pi × r²

plus

the area of that rectangle

length × width = height × 2 × pi × r

that is

height×2×pi×r + 2×pi×r² = 2×pi×r×(height + r)

in our case now

surface area = 2×pi×10.2×(2200 + 10.2) =

= pi×20.4×2210.2 =

= 141,648.3809... cm² =

= 14.16483809... m²

≈ 141,648.38 cm²

≈ 14.16 m²

remember, because

1 m = 100 cm

then

1 m² = 1 m × 1 m = 100 cm × 100 cm = 10,000 cm²

1 m³ = 1 m × 1 m × 1 m = 100 cm × 100 cm × 100 cm =

= 1,000,000 cm³

Please help i need help on pre-calc

Answers

Answer:

32.5 square units

Step-by-step explanation:

Area of triangle = ½ ab sin C

where a and b are to sides that meet at angle C.

Area of triangle = ½ (13)(10) sin 150

= 32.5 square units.

please see attachment for a visual

the area of a triangle is 16cm^2, if the base of the triangle is two less than its height. find the base and the height​

Answers

Answer:

The base of the triangle is 4cm and the height is 6cm

2+2 how to do first year rough

Answers

it’s obviously 22 u do 2+2 which would give 22

I need help!!!!!!!!!!!!!!!!!!

Answers

p+T+S+S=5+5 it is our answer it is write

Sandra is traveling 15 mph on her bicycle. After 4 hours, how far will she have traveled?

Answers

Answer:

→ 15m/hr * 4hr = 60! ←

Hope This Helps On You're Quiz/Assignment

15/4 = 3.75
Speed/DistancexTime

find the diameter of the crcle with the gven circmfence . use 3.14
c=31cm

Answers

The diameter of the given circle is 9.87 cm.

Given.

Circumference = 31 cm

Now,

Circumference of circle = 2×π×r

r = Radius of Circle

Substitute the value of circumference in the formula,

31 = 2×π×r

31 = 2× 3.14 × r

r = 4.935 cm

Diameter of circle is double the radius of circle,

D = 2r

D = 2(4.935)

D = 9.87 cm

Hence diameter of the circle is 9.87 cm.

Learn more about circle,

https://brainly.com/question/22516483

#SPJ1

please look at the picture

Answers

6x-7y=-10

12x-5=16

2xay=10

-10+16+x=10

10=-10+16+x=6x

6x+10=16x

ay=16x

Felipe rented a truck for one day. There was a base fee of $17.95, and there was an additional charge of 86 cents for each mile driven. Felipe had to pay $270.79 when he returned the truck. For how many miles did he drive the truck?

Answers

Answer:

421.4 miles

Step-by-step explanation:

Numner of miles= ($270.79-$17.95)/86 cents

= $252.84/$0.60

=421.4 miles

Other Questions
a trader has a put option contract to sell 100 shares of a stock for a strike price of $60. consider the following scenarios: i. a $2 dividend being declared ii. a $2 dividend being paid iii. a 5-for-2 stock split iv. a 5% stock dividend being paid. use the information above to answer the following question: what is the effect on the terms of the contract of scenario iv? the put option contract gives the right to sell 95 shares for $56.86 the put option contract gives the right to sell 105 shares for $57.14 no effect. the put option contract gives the right to buy 105 shares for $57.14 the put option contract gives the right to buy 95 shares for $56.86 Circle the section on the dna template where the example primer would bind in the following sequence:3' ATTGCGCATTCCGATGGCTCGGAATAAGGCCGTCCTATTCAT 5'Example Primer: 5' ATTCCG 3' you are an it technician for your company. your boss has asked you to set up and configure the sick role is defined as? group of answer choices the pattern of expectations that define appropriate behavior for the sick and for those who take care of them the social sanctions faced by a person who claims to be sick for too long an illnesses that is questioned or considered questionable by some medical professionals the discriminatory practices used by corporations when an employee takes sick leave Array elements must be ________ before a binary search can be performed.A) summedB) set to zeroC) sortedD) positive numbersE) None of these where is a time-temperature indicator (tti) most commonly found? what is the most compacted form in which dna is found during interphase of the cell cycle? Answer choices A-y=3xB-y=4x-2C-y=-x+5F-y=x+3E-y=-2x-4F-y=x+3 at what level of output will average variable cost equal average total cost? when examining a client who has abdominal pain, a nurse should assess: a rate for a specific population subgroup (e.g. death rate for 4050 year olds) is referred to as 12 Select the correct answer. Which line from the text supports the inference that Juliet will pursue her interest in Romeo? . OB. OC. OD. Good pilgrim, you do wrong your hand too much. His name is Romeo, and a Montague, The only son of your great enemy. Come hither, Nurse. What is yond gentleman? Prodigious birth of love it is to me. That I must love a loathed enemy. Reset Next If the net present value is negative, it means that the return on the investment is:a. less than the discount rateb. more than the discount ratec. equal to the discount rated. acceptablee. it doesn't mean anything since the return on the investment bears no relationship to the discount rate. what is the role of the spermaceti in the sperm whale? How can droughts be triggered by: Human activities 2. hypothesis testing - setup: the american mathematical association claims that less than 60% of all americans like statistics. in a random sample of 80 americans, 55% of them liked mathematics. suppose you were to test the claim of the american mathematical society. Which of the following is given to a software interface with a system that allows code execution?A. Intentional Electromagnetic Interference (IEMI)B. National Institute of Standards and Technology (NIST)C. ProxyD. Command shell If global climate change causes rain and temperature patterns to shift dramatically in a region,A) plate tectonic action may dramatically change.B) ocean levels could suddenly drop.C) the region's biomes may shift to other types.D) the region's biodiversity may suddenly increase. Create x and y vectors from -5 to +5 with a spacing of 0.1. Use the meshgrid function to map x and y onto two new two-dimensional matrices called X and Y. Use your new matrices to calculate vector 2, with magnitude Z = sin x2 + y2 Title and label all axes. Include code and graphs. (a) Use the mesh plotting function to create a three-dimensional plot of Z. [5 Marks] (b) Use the surf plotting function to create a three-dimensional plot of Z. Compare the results you obtain with a single input (Z) with those obtained with inputs for all three dimensions (X, Y, Z). (5 Marks] (c) (d) Modify your surface plot with interpolated shading. Try using different colormaps. [2 marks] Generate a contour plot of Z. [3 Marks] Set up manually a colormap for parts (c) and (d), by determining the limits of the colorbar based on the plotted function and use a different colour for each range of values on the colorbar. (5 Marks] Generate a combination surface and contour plot of Z. (5 Marks) Solve for a. 24 = 6(3a - 5) a = [?]