You can afford a $1050 per month mortgage payment. You've found a 30 year loan at 7% interest.

a) How big of a loan can you afford?

b) How much total money will you pay the loan company?

c) How much of that money is interest?

Answers

Answer 1

(a) Loan you can afford is $143097.67. (b) Total money will you pay the loan company is $378000. (c) Interest amount is $234902.33.

What is Loan interest ?

Loan interest is the additional cost that a borrower must pay on top of the principal amount of a loan. Interest is typically expressed as a percentage of the principal and is charged over a specific period of time. The rate of interest charged on a loan is determined by a variety of factors, including the borrower's creditworthiness and the type of loan. The purpose of interest is to compensate the lender for the risk and cost of providing the loan.

Given data:

Principal = $1050 per month

Time = 30 year

        = 30 × 12

        = 360 months

Interest rate = 8%  

                    = 0.08/12

                    = 0.006667 monthly

(a) We get here first maximum amount of loan by present value of annuity as

Present value of annuity = principal ×  [tex]\frac{1-(1+rate)^{-t} }{rate}[/tex]           .........(1)

Put here value we get

value of annuity = 1050 × [tex]\frac{1-(1+0.006667)^{-360} }{0.006667}[/tex]

value of annuity = $143097.67

(b) Total amount  = principal × time period

                            = $1050 × 360

                            = $378000

(c) Total amount of interest paid will be

interest amount = total amount paid - loan amount

interest amount  = $378000 - $143097.67

interest amount  = $234902.33

To Learn More about interest follow link  : https://brainly.com/question/14418534

#SPJ1  


Related Questions

Is the following statement linear or exponential?
Lalo's hair is also known to grow rapidly. It began at a length of 6 in and grew at a constant rate of 1 in per month. HELP PLEASE Nobody is helping me :(

Answers

Answer:

Step-by-step explanation:

exponential

John drew a triangle with side lengths of 5, 12 and 13. His friend, Bryan, looked at it and asked John if it is a right triangle. John’s response was yes. Explain or show how John can prove to Bryan that the triangle is a right triangle

Answers

It's a right angle as 13² is the addition of 5² and 12².

How to prove the right angle?

A right triangle or right-angled triangle, or more formally an orthogonal triangle, formerly known as a rectangled triangle, is a triangle with one right angle, i.e. two perpendicular sides. Trigonometry is founded on the relationship between the sides and other angles of a right triangle.

In this case, the values given are 5, 12 and 13. This will be illustrated thus:

5² + 12² = 13²

25 + 144 = 169

169 = 169

This was done based on Pythagoras theorem.

Therefore, it's a right angle.

Learn more about triangles on:

https://brainly.com/question/17335144

#SPJ1

Consider the function f(x)=x³+7 x²-36
1. Consider the function f(x)=x³+7 x²-36.
a. [1 pts] Find f(2).
b. [4 pts] Factor f(x). Show all your work. (Hint: You can use the fact that if f(a)=0, then the f(x) must have (x-a) as a factor.
2. Miguel decided to invest some of his money in an account gaining $3 % interest compounded semiannually. He ultimately would like to purchase a 560,000 car.
a. [5 pts] How much would he have to invest initially to have the necessary money in 4 years? Round your answer to the nearest whole dollar

Answers

By using the concept of factorization and compound interest, it can be calculated that-

1a) f(2) = 0

 b) f(x) = (x - 2)(x + 6)(x + 3)

2)   Miguel must initially invest 497118.23

What is factorization and compound interest?

Factorization is the reduction of an algebraic expression into two or more algebraic expressions of smaller degree

If the interest on a certain principal at a certain rate over a certain period of time increases exponentially rather than linearly, the interest earned is called compound interest.

1) a) f(x) = x³+7 x²-36

      f(2) =  2³+7(2)²-36

      f(2) = 36 - 36 = 0

  b) Since f(2) = 0, (x - 2) is a factor of f(x)

      f(x) =  x²(x - 2) + 9x(x - 2) + 18(x - 2)

      f(x) = (x - 2)(x² + 9x + 18)

      f(x) = (x - 2)(x² + 6x + 3x + 18)

      f(x) = (x - 2){x(x + 6) + 3(x + 6)}

      f(x) = (x - 2)(x + 6)(x + 3)

  c) Let the principal be $p

      Rate = 3%

      Time = 4 years

      [tex]560000 = p(1 + \frac{3}{200})^{4 \times 2}\\\\560000 = p(\frac{203}{200})^8\\\\\\p = 560000 \times (\frac{200}{203})^8\\\\p = 497118.23[/tex]

      Miguel must initially invest 497118.23

To learn more about compound interest and factorization, refer to the link-

https://brainly.com/question/24274034

#SPJ4

     

     

What is the solution to the division problem below? (You can use long division or synthetic division.)
(2x2 + 7x-15) - (x+ 5)

Answers

The answer would be 2x-3
2x-3
X+5 | 2x^2+7x-15
2x^2+10x
-3x-15
-3x-15

Show the optimal binary search tree for the following words, where the frequency
of occurrence is in parentheses: a (0.18), and (0.19), I (0.23), it (0.21), or (0.19).

Answers

The optimal binary search tree for the given frequency is attached below.

Binary search tree:

Binary search tree refers the value of left node must be smaller than the parent node, and the value of right node must be greater than the parent node.

Given,

Here we have to plot  the optimal binary search tree for the following words, where the frequency of occurrence is in parentheses: a (0.18), and (0.19), I (0.23), it (0.21), or (0.19).

In order to plot the binary search tree, we have to do the following steps,

First, we have to insert 0.18 into the tree as the root of the tree.Now, then read the next element; if it is smaller than the root node, insert it as the root of the left subtree, and move to the next element.Whereas, if the element is larger than the root node, then insert it as the root of the right subtree.

Then we get the binary search tree like the following.

To know more about Binary search tree here.

https://brainly.com/question/28391940

#SPJ4

find the mean weight and variance of the following students in kilograms 50,70,58,62,66,53 and 76​

Answers

Answer:

The answer is 62 and 86

Step-by-step explanation:

Mean

(50 + 70 + 58 + 62 + 66 + 53 + 76) ÷ 7

435/7 = 62.1 ≈ 62

Variance

(50 - 62)² + (70 - 62)² + (58 - 62)² + (62 - 62)² + (66 - 62)² + (53 - 62)² + (76 - 62)²

(144 + 64 + 16 + 0 + 16 + 81 + 196)/(7 - 1)

517/6 = 86

Thus, The mean of the given data is 62 and Variance is 86

Music Company A charges a 15$ membership fee and 0.75$ each to download a song. Music Company B charges 0.90$ each to download a song with no membership fee.

a. For what number of songs will both companies charge the same amount? Justify your answer using mathematics.
_________ Songs
You anticipate that you will download 150 songs. Which company should you choose if you want to spend the least amount of money? Justify your answer using mathematics.
________ (Type Company A or Company B)

Answers

a. Using linear equations in one variable we get the number of songs at which both companies would charge the same amount is 100 songs.

b. Company B would be a better choice as the total charges for 150 songs would be $127.5.

Explain linear equations in one variable.

A straight line with only one variable is a linear equation. the single variable's power is 1. Simple algebraic methods are used to solve these equations, which have the form ax+b=0.

a) Assume the number of songs downloaded is 'x'.

Now according to the question,

Total charges by company A is 15+0.75x

Total charges by company B is 0.90x

For equal charges, both must be equal,

Hence equating the 2 expressions we get,

15+0.75x=0.90x

15=0.15x

x=100

Hence total number of songs to reach the charge of the same amount is 100.

b)Let us take 150 songs from company A, we get the total charge to be

15+0.75*150=$127.5

Taking for company B, we get

0.90*150=$135.

We see that for 150 songs, the charges of company A is less compared to company B. Therefore I would choose company B over company A.

To learn more about linear equations in one variable, visit the following link:

https://brainly.in/question/19457238

#SPJ4

b) On the grid draw the graph of x + y = 6
for values of x between -2 and 3.

Answers

Answer:

x=1   y=6

Step-by-step explanation:

???

5/6 q - 1/3 q = 2/5

Please explain step by step on how I could get this answer

Answers

Answer:

4/5

Step-by-step explanation:

5/6q-1/3q=2/5

We change the coefficient’s denominators to 6 so we can subtract them

5/6q-2/6q=2/5

3/6q=2/5

1/2q=2/5

Now divide both sides by 1/2 or multiply both sides by 2

1/2q=2/5

/1/2.  /1/2

q=2/5/1/2

q=2/5*2/1

q=4/5

Hopes this helps please mark brainliest

Pls answer free brainliest

Answers

The expression that is a factor of the polynomial x³ + 2x² - 9x - 18 is (x + 2).

How to find the factors of a polynomial?

Factoring of a polynomial is the method of breaking the polynomial into a product of its factors.

For example x² - 4 can be broken as (x - 2) and (x + 2).

Therefore, the expression that factor the polynomial x³ + 2x² - 9x - 18 is as follows:

Therefore,

x³ + 2x² - 9x - 18 = (x - 3)(x² + 5x + 6)

Let's break (x² + 5x + 6) down

x² + 5x + 6

x² + 2x + 3x + 6

x(x + 2) + 3(x + 2)

(x + 3)(x + 2)

Therefore, the factors are (x + 3)(x + 2) and (x - 3)

learn more on polynomial here: https://brainly.com/question/29089358

#SPJ1

Answer:

The answer is C, (x+2).

Your business has conducted five market research surveys in the past year. The cost per survey is as follows: Survey 1: $725 Survey 2: $850, Survey 3: $1,250, Survey 4: $1,350, Survey 5: $900. What is the median cost of the market research surveys?


a) $900
b) $1,015
c) $1,092
d) $1,250

Answers

The median cost of the market research surveys is $900 so option (a) is correct.

What are the mode and median?

Mode is the highest frequency number while the median is the middle value of a data set after writing in either an increasing or decreasing manner.

As per the given surveys,

Survey 1: $725 Survey 2: $850, Survey 3: $1,250, Survey 4: $1,350, Survey 5: $900.

Write the surveys in the increasing format as

$175,$850,$900,$1250,$1350

The median will be the middle value thus $900 will be correct.

Hence "The median price of the surveys for market research is $900".

To learn more about mode and median,

brainly.com/question/300591

#SPJ1

A cookie recipe calls for 4 cups of flour for every 1 cup of sugar. If you want to make multiple batches of the cookies and you use 8 cups of sugar, how much flour will you use?

Answers

Answer:

8x4=32

Step-by-step explanation:

I hope I helped you

Where, if anywhere, does h(x) = m(x) when h(x) = (x+2)^2-9 and m(x) = x-10

Answers

Answer:

Where, if anywhere, does h(x) = m(x) when h(x) = (x+2)^2-9 and m(x) = x-10

wut do i have to find

Step-by-step explanation:

fill in the blank so that the equation is a prefect square trinomial

Answers

In order for this to be a perfect square trinomial all numbers must have an even square root. Therefore the answer is C.

Brainliest is appreciated. Please I only need one more!!!!!!!!!!!!!!!!

PLEASE HELP ASAP!!! Will IMMEDIATELY give Brainliest to the correct answer!! 100 pt question!!

The function f(x)=∣x−3∣ can be used to determine how far a number x is away from the number 3 on the number line. Find and interpret the given function values and determine an appropriate domain for the function.

Answers

Answer:

The function f(x) = |x - 3| can be used to determine how far a number x is away from the number 3 on the number line. To find the function value for a given x, we first need to subtract 3 from x and then take the absolute value of the result. For example, if x = 5, then the function value would be f(5) = |5 - 3| = |2| = 2.

The domain of the function is the set of all possible values of x that we can plug into the function to get a real number result. In this case, the function will work for any real number value of x, so the domain of the function is the set of all real numbers, which can be written as:

Domain: (-∞, ∞)

In other words, the function f(x) = |x - 3| can be used to determine how far any real number x is away from the number 3 on the number line.

SUPER URGENT!
20 points!!


picture required

Answers

180-90= 90

So the sun angle = 90

Any help on this question

Answers

Using trigonometric relations we will see that:

a =  5*√3

b = 5

The correct option is the one you marked.

How to get the values of a and b?

For a right triangle with a known hypotenuse H and a known angle x, we can use the trigonometric relations:

cos(x)= (adjacent cathetus)/h

sin(x) = (opposite cathetus)/h

Here the hypotenuse measures 10 units, and the known angle is x = 30°.

The adjacent cathetus to that angle is a, so we can write:

cos(30°) = a/10

a = cos(30°)*10  = 10*√3/2 = 5*√3

And b is the opposite cathetus:

sin(30°) = b/10

b = 10*sin(30°) = 5

Then the correct option is the one you marked.

Learn more about right triangles:

https://brainly.com/question/2217700

#SPJ1

Find the value of $x$ so that $3^x = (-27)^{-6}$.

Answers

[tex]3^x=(-27)^{-6} \\ \\ 3^x=(-3^3)^{-6} \\ \\ 3^x=(3^3)^{-6} \\ \\ 3^x=3^{-18} \\ \\ \boxed{x=-18}[/tex]

What is the correct to this answer ???? ( answers only)

Answers

Answer:

x>9

Step-by-step explanation:

2x-5>13

2x>13+5

2x>18

x>18/2

x>9

Answer:

x > 9

Step-by-step explanation:

To find the solution to this inequality we need to follow these steps:

2x - 5 > 13

add 5 to both sides

2x > 18 (-5 will be eliminated by +5 on the left side while 13 will be 18 when 5 added to it)

divide both sides by 2

x > 9

Ima needs an at least B help me out here Please.

What number makes the expressions equivalent?


−1.1−1.4m + 0.4 = ? − 1.4m

Answers

By using the concept of algebraic expression, it can be calculated that

The number that makes the expressions equivalent is -0.7

What is algebraic expression?

Algebraic expression consist of variables and numbers connected with addition, subtraction, multiplication and division.

The given algebraic expression is

−1.1−1.4m + 0.4

On simplifying −1.1−1.4m + 0.4

−1.1−1.4m + 0.4

-0.7 - 1.4m

So the number that makes the expressions equivalent is -0.7

To learn more about algebraic expression, refer to the link-

https://brainly.com/question/4344214

#SPJ1

Find a linearization at a suitably chosen integer near a at which the given function and its derivative are easy to evaluate. f(x) = x^(-1), a = 0.9

Answers

A linearization at a suitably chosen integer near a at which the given function and its derivative are easy to evaluate is L(x)=-6 -4x .

What is function ?

A function is a type of rule that produces one output for a single input. Source of the image: Alex Federspiel. This is illustrated by the equation y=x2. Any input for x results in a single output for y. Considering that x is the input value, we would state that y is a function of x.

Nearest integer is x =-1

Centre of linearization as x =-1

f(x)=3x2 +2x -3

f(-1)=3(-1)2 +2(-1) -3

f(-1)=-2

f(x)=3x2 +2x -3

f '(x)=6x +2

f '(-1)=6(-1) +2

f '(-1)= -4

L(x)=f(-1) + f '(-1) (x-(-1))

L(x)=-2 -4(x+1)

L(x)=-2 -4x -4

L(x)=-6 -4x

To learn more about function visit:https://brainly.com/question/21145944

#SPJ4

Two people receive an e-mail. Every day, the number of people who receives the e-mail triples. If people continue to receive the e-mail at this rate, how long will it take until 4,374 people receive the e-mail?

Choose the equation for the number of people who receive the e-mail, E, in terms of the number of days since the first e-mail was sent, d, and the correct solution.

PLS HELP

Answers

Answer:

Step-by-step explanation:

First, you will multiply 2 times 4,374 and get 8,748 then you will divide 8748 by 7 which is a week, and get 1249.7 then you will divide it by 356 which is a year approximate, and get 10.51 days.

A diver starts out at 426 feet below the surface (or -426 feet). She then swims upward 212 feet. Use a signed number to represent the diver's current depth

Answers

Step-by-step explanation:

this is a college question ?

oh, my dear ...

we start at -426 ft.

swimming upwards reduces depth by adding hight.

so,

-426 + 212 = -214 ft

basically the same method is used as if we would subtract 212 from 426.

so, the diver is currently at -214 ft (214 ft below the surface).

Find the angle between 0 and 2π in radians that is coterminal with the angle -25π/6

Answers

Hi,

I hope you and your family are doing well!

An angle is coterminal with another angle if it has the same terminal side as the other angle, but may have a different degree measure. In other words, coterminal angles are angles that are measured around the same point on the unit circle, but may start at different points.

To find the angle between 0 and 2π in radians that is coterminal with the angle -25π/6, we can add or subtract multiples of 2π to -25π/6 until we get an angle between 0 and 2π.

For example, adding 2π to -25π/6 gives us:

-25π/6 + 2π = -π/6 + 2π = 7π/6

This angle is between 0 and 2π, so it is coterminal with -25π/6.

Alternatively, subtracting 4π from -25π/6 gives us:

-25π/6 - 4π = -29π/6 = -π/2

This angle is also between 0 and 2π, so it is coterminal with -25π/6.

Therefore, the angle between 0 and 2π in radians that is coterminal with -25π/6 is either 7π/6 or -π/2.

Please give this answer 5 stars and brainliest if you find it helpful.

Happy Holidays & New Year!

Unless specified, all approximating rectangles are assumed to have the same width. Evaluate the upper and lower sums for f(x) = 1 + cos - SXST, with n = 3, 4, and 6. Illustrate each case with a sketch similar to the figure shown below.

Answers

The upper and lower sums for f(x) = 1 + cos - SXST, with n = 3, 4, and 6 is 10.1913798 and 10.19913798.

What is upper and lower sums?

Using rectangles that are both enscribed in and circumscribed by a curve, we may approximate the area under a curve. The total area of the rectangles that are inscribed is the lower sum, while the total area of the rectangles that are circumscribed is the higher sum.

[tex]$n=6: \quad \Delta x=\frac{2 \pi}{6}$[/tex]

[tex]\begin{aligned}& \text { Lower sum }=\frac{2 \pi}{6}\left[f(-\overline{4})+f\left(-\frac{2 \pi}{3}\right)+f\left(-\frac{\pi}{3}\right)+f(0)+f\left(\frac{\pi}{3}\right)+f\left(\frac{2 \pi}{3}\right)\right] \\& c_6=\frac{2 \pi}{6}[1+1.5+1.8660256+2+1.8660254+1.5] \\& c_6=10.1913798\end{aligned}[/tex]

upper sum:

[tex]\begin{aligned}& =\frac{2 \pi}{6}\left[f\left(-\frac{2 \pi}{3}\right)+f\left(-\frac{\pi}{3}\right)+f(0)+f\left(\frac{\pi}{3}\right)+f\left(\frac{2 \pi}{3}\right)+f(\pi)\right] \\R_6 & =\frac{2 \pi}{6}[1.5+1.8660254+2+1.8660254+1.5+1] \\R_6 & =10.1913798]\end{aligned}[/tex]

To learn more about upper and lower sums visit:https://brainly.com/question/17019015

#SPJ4

Which is equivalent to 64 1/4 ?
O24^4
04
O 16
O 1644
Help me pls !! Being timed !

Answers

The value equivalent to   [tex](64)^{1/4}[/tex] is [tex]2\sqrt[4]{4}[/tex].

What is meant by an expression?

An expression or mathematical expression is a finite arrangement of symbols that are well-formed in line with context-dependent criteria. To help define the logical grammar and order of operations, mathematical symbols can be used to represent variables, operations, functions, brackets, punctuation, and grouping.

A formula and an expression are often distinguished by authors, with the former designating a mathematical entity and the latter a statement about such a thing.

But in contemporary mathematics, and particularly in computer algebra, formulas are seen as expressions that can be evaluated as true or false, depending on the values given to the variables present in the expressions.

Given expression is  [tex](64)^{1/4}[/tex]

The number 64 can be written as 2 × 2 × 2 × 2 × 2× 2 =2⁶

So, the above given expression becomes,

[tex](64)^{1/4}[/tex]=[tex](2^{6}) ^{1/4}[/tex]

2⁶=2⁴.2²

So,

[tex](2^{6}) ^{1/4}[/tex]=[tex](2^{4} 2^{2})^{1/4}[/tex]

By simplifying we get,

[tex](64)^{1/4}[/tex]=[tex]2\sqrt[4]{4}[/tex]

To know more about expression, visit:

https://brainly.com/question/28170201

#SPJ1

3y^2 + 3(4y^2 - 2) please help

Answers

The roots of the quadratic equation 3y² + 3(4y² - 2) is ± √(1/7).

What is a quadratic equaton?

A quadratic equation is an algebraic expression in the form of variables and constants.

A quadratic equation has two roots as its degree is two.

Given, 3y² + 3(4y² - 2).

3y² + 12y² - 2.

14y² - 2.

Let 14y² - 2 = 0.

14y² = 2.

y² = (2/14).

y = ± √(2/14) Or ± √(2/2×7) Or ± √(1/7).

learn more about quadratic equations here :

https://brainly.com/question/17177510

#SPJ1

consider the following method. public int pick(boolean test, int x, int y) { if (test) return x; else return y; }

Answers

If P is the minimum number of tests to achieve full statement coverage for f(x) and Q is the minimum number of tests to achieve full branch coverage for f(x), then (P,Q) =(3, 4)

Branch coverage: During program testing, every branch in a statement must be run at least once.

Coverage of the statement:

This means that during testing, every statement in the computer code must be run at least once.

All of the statements must be executed in order to obtain complete statement coverage.

Statement coverage is calculated as (statement executions divided by total statement executions).

To obtain complete statement coverage in the code above, two test cases are necessary.

Case 1: If the if condition is satisfied,

{

int res=0;

if(m<0) {res=n-m;}

return res;

}

These commands will be carried out.

Case 2: All remaining statements will also be put into effect when the other two cases of else do. Full statement coverage is attained after three tests.

Branch coverage: It includes both true and false situations and is decision-based.

To learn more about methods

brainly.com/question/27463039

#SPJ4

K
Problem Solving
X 4.3.PS-7
Simplify the expression.
-2.6f+0.2f-15-9
-2.6f+0.2f-15-9=
(Simplify your answer. Use integers or decimals for any numbers in the

Answers

Answer:

(23x+4.2)

Step-by-step explanation:

What are the zeros of this function?

Answers

Answer:

B. x = 0 and x = 5

Step-by-step explanation:

The zeros of this function are x = 0 and x=5

_________________

Have a great day!

Other Questions
a nurse teaches an adolescent client with asthma to independently administer breathing treatments. which principle should the nurse keep in mind when planning the teaching session? 1. compute total variable cost per unit. 2. compute total fixed costs. 3. prepare a flexible budget at activity levels of 12,000 units and 16,000 units. Can anyone help me out. Really need this turned in Solve x for this diagram why did the framers of the constitution put the principles of checks and balances and separation of powers in the constitution? can someone help me on this thank you and help me as soon as possible please. the following figure shows the general steps that occur when a researcher uses the crispr-cas9 system to modify a protein-encoding gene in a eukaryotic cell with the goal of modifying the protein product. drag the descriptions of the steps to their appropriate locations on the figure. Based on your knowledge of the compounds and the visible light spectra, label thecompounds in increasing energy order of energy of the light that was emitted.Lowest EnergyLithiumCopperHighest EnergyCalciumPotassiumBariumSodiumStrontium The classroom outside bag had 5 frisbees in it. If 25% of the outside toys are frisbees, then how many total toys are in the bag? Suppose your gross monthly income is $6,500 and your current monthly payments are $525. If thebank will allow you to pay up to 38% of your gross monthly income (less current monthly payments)for a monthly house payment, what is the maximum loan you can obtain if the rate for a 25-yearmortgage is 8.65%? 7.) Given the following triangle, what is the value of x and the value of y ? Venezuela declares independence from Spain. A chemist measures the temperature of a solution in C. The measurement is denoted C, and is normally distributed with mean 40C and standard deviation 1C. The measurement is 1.8C32. What is the distribution of F? a) F N(104,3.24) b) F N(104,1.80) c) F N(40,3.24) d) F N(40,1.80) Which sentence best supports the claim that Oceanians will not leave any type of legacy behind after death?Select one:a. Her feelings were her own, and could not be altered from outside.b. Whatever happened you vanished, and neither you nor your actions were ever heard of again.c. They were governed by private loyalties which they did not question.d. They were not loyal to a party or a country or an idea, they were loyal to one another. what is the concentration of a solution prepared by mixing 5.00 ml of deionized water with 3.00 ml of a 1.31 m solution? 1. Which two important latitudes cross the continent of North America? Classify these sequences based on their potential to modify protein products. The plain letters in the sequences represent protein coding regions, and the bold letters represent noncoding regions.TACCTTAATT TACCTTAATTATTGAGACCGT GAGACCAGT HELPPP PLEASE ASPPP!!!!!! Examine the graph below. Calculate the slope. Find the absolute extrema if they exist, as well as all values of x where they occur, for the function f(x)=(x-64)^{1/11} on the domain [-8,9]Select the correct choice below and, if necessary, fill in the answer boxes to complete your choice.A. The absolute maximum is , which occurs at x= (Round the absolute maximum to two decimal places as needed. Type an exact answer for the value of x where the maximum occurs. Use a comma to separate answers as needed.)B. There is no absolute maximum. What challenges you face during a searching for a business conference ? Explain