a kid uses a slingshot to shoot a rock at a target. when the kid applies a net force of 8.68 N forward, the rock accelerates at a rate of 12.4 m/s^2 forward. What is the rocks mass?

Answers

Answer 1

Answer:

0.7kg

Explanation:

Given parameters:

Force on the rock  = 8.68N

Acceleration  = 12.4m/s²

Unknown:

Mass of the rock  = ?

Solution:

From newton's second law of motion, the net force on a body is the product of mass and acceleration

  Net force  = mass x acceleration

Now insert the parameters and solve the problem;

         8.68  = mass x 12.4

          mass = [tex]\frac{8.68}{12.4}[/tex]  = 0.7kg


Related Questions

A player throws a javelin at an unknown angle with a horizontal velocity 20 m/s and vertical velocity 60 m/s. Find its angle and resultant velocity.

Answers

Answer:

63º~64º

Explanation:

so imagine a graphic with a triangle. The distance between the zero and the horizontal (x) is 20 and the distance between 0 and vertical (y) is 60

20 = base

60 = height

hypotenuse = L

tg = cato/cata

tg = 60/20

tg = 2

I give up

A 2 kg object is a distance of 10,000,000 m away from the center of Earth, which has a mass of nearly 6×1024 kg. What is the approximate gravitational field strength of Earth’s gravitational field at the location of the 10 kg object?


A2 N/kg

B 4 N/kg

C 10 N/kg

D The gravitational field strength is negligible and, therefore, approximately zero.

Answers

Answer:

4 (N/kg) or B

Explanation:

An application of the equation for Newton’s law of universal gravitation can be used to determine the gravitational field strength at the 2 kg object’s location.

The approximate gravitational field strength of Earth’s gravitational field at the location of the 10 kg object is 4.00 N/kg. Hence, option (B) is correct.

Given data:

The mass of object is, [tex]m = 2\;\rm kg[/tex].

The distance of object from Earth is, [tex]d=10,000,000\;\rm m[/tex].

The mass of Earth is, [tex]M=6 \times 10^{24} \;\rm kg[/tex].

The expression for the gravitational field strength of Earth is,

[tex]g = \dfrac{GM}{d^{2}}[/tex]

Here, G is the universal gravitational constant and its standard value is [tex]6.67\times10 ^{-11} \;\rm Nm^{2}/kg^{2}[/tex].

Solve by substituting the values as,

[tex]g = \dfrac{6.67 \times 10^{-11} \times 6 \times 10^{24}}{(10,000,000)^{2}}\\g \approx 4.00 \;\rm N/kg[/tex]

Thus, we can conclude that approximate value of gravitational field strength of Earth at the location of object is 4.00 N/kg. And option (B) is correct.

Learn more about gravitational field strength here:

https://brainly.com/question/15091823?referrer=searchResults

Help thank you...............

Answers

Answer:

do explain what u need help with?


What is the speed of the netball as it hits
the ground? Use the information from 1.5m
above ground level


mass= 0.4

Answers

Answer:

v = 5.42 [m/s]

Explanation:

To solve this problem we have to use the concept of energy transformation which tells us that kinetic energy is transformed into potential energy and vice versa.

The potential energy can be defined by means of the following equation.

Ep = m*g*h

where:

m = mass = 0.4 [kg]

g = gravity acceleration = 9.81 [m/s²]

h = elevation = 1.5 [m]

Ep = 0.4*9.81*1.5

Ep = 5.88 [J]

Since the potential energy is equal to the kinetic energy, we can find the velocity by means of the kinetic energy equation.

Ek = 0.5*m*v²

where:

Ek = kinetic energy  = 5.88 [J]

5.88 = 0.5*0.4*v²

v = 5.42 [m/s]

25 points! Will give brainliest!

1. Draw the diagram

2. List the Givens

3. Select the correct equation to solve for and manipulate the equation

4. Substitute the given values


A ball is thrown horizontally from the roof of a building 60 m tall with a speed of 6.9 m/s.

a.How much later does the ball hit the ground?

b. How far from the building will it land?

c. What is the velocity of the ball just before it hits the ground?

Answers

Answer:

B my brother say that it was

Examine the weather map.

A weather map of the United notes. The following are shown on the map: major cities with high and low temperatures; high and low pressure systems; types of precipitation, fronts. The arrow is pointing to an H in a circle.

What does the symbol indicated by the arrows most likely represent?

a hurricane
low pressure
high pressure
high temperatures

Answers

Answer:

High pressure.

Explanation:

The symbol H indicates high pressure, while the symbol L indicates low pressure. Therefore, option C is correct.

What is a weather map?

A weather map is a map of the world or a portion of it that uses symbols to depict the weather conditions at a given time, including temperature, pressure, wind speed and direction, humidity, clouds, visibility, and type and amount of precipitation.

Different kinds of weather maps are used by meteorologists to display forecasts. Satellite, Doppler radar, precipitation, temperature, and wind speed are the primary weather maps. Let's investigate each of these in greater depth. There are four types of weather maps and that is station model map, aviation map, temperature map, and streamline map.

The symbol H indicates high pressure. Therefore, option C is correct.

Learn more about weather maps, here:

https://brainly.com/question/1674348

#SPJ3

If 32 g of copper(II) sulfate are dissolved in 100 g of water at 20°C, is the solution produced saturated, unsaturated, or supersaturated?​

Answers

If we now heat the mixture to 50 °C, the remaining 9 g of glucose will dissolve. At the new temperature, the solubility limit in 100 mL of water is 244 g glucose. With only 100 g of glucose dissolved, the solution is now unsaturated.
If we next cool the mixture back to 25 °C, 9 g of glucose should precipitate from solution.
If glucose crystals do not form, the system has more dissolved glucose (100 g) than it can hold at 25 °C (91 g). We have a supersaturated solution.
The first step in the formation of crystals is nucleation. This is when the solute molecules arrange themselves to form crystals.
Sometimes this happens at once. If it doesn't, we have a supersaturated solution. This is an unstable situation.
A piece of dust or a small crystal of the solute, a seed crystal, provides a template for crystallization of the excess solute. The excess solute starts to form crystals on the nuclei.

When copper sulfate is dissolved in water, the solution produced is saturated.

What is saturated solution?

When the solute added over and over is no more able to dissolve, the solution formed is saturated.

For a certain amount of solvent, temperature and pressure, the solute is unable to dissolve and precipitate or from crystals. This condition is best termed as the saturated solution. So, the solvent can not dissolve any more solute.

Thus, the solution produced is saturated.

Learn more about saturated solution.

https://brainly.com/question/1851822

#SPJ2

Restaurant owners agree to comply with state, but not federal, health

regulations when applying for a public health license. true or false

Answers

Answer:

False.

Explanation:

A public health license can be defined as series of privileges and authority granted to a practitioner in the public domain, to offer services to the general public after admitting to comply with the standards, rules and regulations set aside by health regulatory agencies and the government (both state and federal).

This ultimately implies that, all restaurant owners must have met the minimum requirements (criteria) and agree to comply with all the standards, rules and regulations with respect to public health before they are endorsed and then given a license to practice or operate by the appropriate agency or authorities.

Hence, restaurant owners agree to comply with state, federal, and health regulations when applying for a public health license.

calculate the densities of the following materials. Material A has a volume of 2 cm 3 and mass of 30 g.​

Answers

Answer:

0.015kgcm^3

Explanation:

density = mass / volume

density = (30/1000) / 2

= 0.015kgcm^3

After a storm, a hospital may have to rely on backup generators to power some equipment. Which is the energy conversion provided by the generators?

A. mechanical to electrical energy

B. thermal to mechanical energy

C. nuclear to mechanical energy

D. thermal to electric energy

Answers

Answer:

in a generator mechanical energy is a device that converts a form of energy into electricty

The energy conversion provided by the generators is: mechanical to electrical energy. Hence, option (A) is correct.

What is working principle of  electric generators?

An electric generator is a device that generates electric energy, which can either be immediately delivered to houses, businesses, and other structures or stored in batteries. Electromagnetic induction is the basis for how electric generators operate.

A horseshoe-shaped magnet's poles are quickly rotated around a conductor coil, which is a copper coil that has been tightly wound onto a metal core. An armature is made up of a conductor coil and a core. The armature is rotated by a mechanical energy source, such as a motor, by means of a shaft connection.

The magnetic field that exists between the magnet's two poles is broken off when the coil turns. The conductor's electrons will interact with the magnetic field, causing an electric current to flow through it.

Learn more about electric generator here:

https://brainly.com/question/15277088

#SPJ2

Mechanical weathering is also called ______weathering

Answers

Answer:

physical

Explanation:

physical weathering and disaggregation, causes rocks to crumble. Water, in either liquid or solid form, is often a key agent of mechanical weathering. For instance, liquid water can seep into cracks and crevices in rock.

The projectile launcher shown below will give the object on the right an initial horizontal speed of 5.9 m/s. While the other object will be dropped with no initial speed. The objects are initially 179 cm above the ground and separated by 142 cm. What will be the difference in the landing locations of the two objects?

Answers

Answer:

104.3 cm  or 179.7

Explanation:

First find time that it takes for the object to hit the ground

[tex]\sqrt{(2H)/g} -> \sqrt{(2 x 179)/ 9.8} = 6.04s\\[/tex]*

Then find xf of projectile [tex]xf= 5.9(6.04) = 37.7\\\\[/tex]

not 100% sure if the projectile is going away from the object or towards it but you either do 142- 37.7   or    142+37.7  

hope that helps

"217 cm" would be the difference throughout the landing locations of the two objects.

Given:

Initial horizontal speed,

v = 5.9 m/s

Height,

h = 179 cm

By applying equation of motion, we get

→               [tex]S = ut+\frac{1}{2}at^2[/tex]

By substituting the values, we get

→ [tex]179\times 10^{-2}=0+\frac{1}{2}\times 9.8\times t^2[/tex]

→            [tex]3.58= 9.8t^2[/tex]

                 [tex]t^2 =\frac{3.58}{9.8}[/tex]

                  [tex]t = \sqrt{0.36531}[/tex]

                     [tex]= 0.61 \ s[/tex]

now,

The horizontal distance travelled by the first particle will be:

→ [tex]d = v\times t[/tex]

     [tex]= 5.9\times 0.61[/tex]

     [tex]= 3.59 \ m[/tex]

or,

     [tex]= 359 \ cm[/tex]

hence,

The distance between particle will be:

= [tex]d -142[/tex]

= [tex]359-142[/tex]

= [tex]217 \ cm[/tex]

Thus the above approach is right.

Learn more:

https://brainly.com/question/18804022

Use GRESA Method to solve for the amount of current that will flow in a lamp with a resistance of 40 ohms when the voltage across the lamp is 15 V.


Help po plss asap answer

Answers

Answer:

the amount of current that will flow in a lamp is

 Q = C. U = 40.15 = 600 (c)

with Q is  the amount of current that will flow in a lamp

       

Explanation:

If the pH of a substance is 12.4, the substance is a _______
- strong acid
- weak acid
- strong base
- weak base

Answers

Answer:

Strong base

Explanation:

A strong base usually has the pH of between 12 to 14

If the pH of a solution is 12.4, the substance is called a Strong base. Hence, option C is correct.

What are acids and bases?

When a substance is dissolved in water, H⁺ hydrogen ions are formed. These substances are called Acids. H⁺ ions are positive ions and hence, they donate protons to other substances.

When a substance is dissolved in water, OH⁻ hydroxyl ions are formed. These substances are called Bases. OH⁻ ions are negative ions that are capable of accepting the protons/hydrogen ions.

Acids are substances having more hydrogen ions than hydroxyl ions and it has a sour taste. Bases are substances having more hydroxyl ions than hydrogen ions and it has a bitter taste.

The acids and bases are differentiated by using the pH scale. pH represents the potential of hydrogen which measures the hydrogen and hydroxyl ions. It is a negative logarithm of H⁺ ion concentration.

The pH scale ranges from 0-14. The neutral power in the pH scale is 7 and the water shows the neutral range. If pH shows less than 7 it is an acidic solution and litmus paper turns red.        

If pH shows greater than 7, it is a base or alkaline solution and the litmus paper turns blue.  Weak bases range from 7.3-10. Strong bases range from 10-14.  

Hence, the pH shows 12.4, which represents a strong base. Thus, the correct solution is C.  

To know more about acids and bases:

https://brainly.com/question/1934578

#SPJ3

20. A cannon shoots a ball at 38 m/s at an angle of 30°. Ignore the original height of the cannon and assume level ground.
a.How long is the cannon ball in the air?

b. How far does the cannon ball travel?

c.What is the maximum height of the cannon ball?

Answers

Answer:
a.3.87s
b.127.36m
c.18.4m

Step by step explanation:
Refer to the diagram

why do the stars appear like pointed objects​

Answers

Answer:

because of where we are and our distance away from them, in reality they're giant balls of burning gas, like the sun. some stars are even bigger than the sun

Explanation:

A person is lifted 24 meters by the elevator in a building. If the
person has a mass of 74 kg, what is the gravitational potential
energy gained by the person? Estimate g to 9.81 and keep 5
significant figures.

Answers

Answer: 17,423 J

Explanation:

Potential Energy = mass x gravity x height

PE = 74kg x 9.81m/s^2 x 24 m

PE = 17,423 J

The required value of gravitational potential energy gained by the person is 17422.56 J.

Given data:

The lifting height is, h = 24 m.

The mass of person is, m = 74 kg.

The energy possessed by the person by virtue of its position is known as gravitational potential energy of the person. The expression for the gravitational potential energy of person is given as,

U  = mgh

Here,

g is the gravitational acceleration.

Solving as,

[tex]U = 74 \times 9.81 \times 24\\\\U =17422.56\;\rm J[/tex]

Thus, we can conclude that the required value of gravitational potential energy of person is 17422.56 J.

Learn more about the gravitational potential energy here:

https://brainly.com/question/19768887

Students want to build a simple motor to demonstrate the relationship between magnetism and electricity. Each student group has a wooden block, paper clips, a battery, and some copper wire. What additional material is necessary to build a simple motor?





A.

An iron nail is necessary to produce a temporary magnetic field.
B.

A magnet is necessary to produce a permanent magnetic field.
C.

An iron nail is necessary to act as the electrical circuit load.
D.

A magnet is necessary to act as the electrical circuit load.

Answers

Answer:

B. A magnet is necessary to produce a permanent magnetic field.

Explanation:

When building a simple motor, a permanent magnet is necessary to produce a magnetic field in which opposite North South polarity which will help in rotating the main copper core when the battery is connected.  

if solid figures have parallel bases and lateral faces how the base will be perpendicular the lateral face​

Answers

Each face of a solid figure is called either a base or a lateral face. Solid figures generally have one or two bases. If it has two, these bases are parallel. If a figure has two parallel bases and lateral faces, such as in a prism, the bases will be perpendicular to the lateral faces.

Radha was making coffee for her sister. She stopped stirring coffee but swirling motion continued for some time .She was wondering how this can happen .Can you help her in explaining in terms of inertia​ ​

Answers

Answer:

Explanation:

Inertia is one of the major properties of all objects which makes an object at rest to be reluctant to move and an object in motion to be reluctant to stop.

Therefore during the stirring of the coffee, the molecules of the mixture were in a continuous circular motion. But after the stirring has ceased, the molecules were reluctant to stop. Thus the motion continues for sometime until some available damping forces acts.

Thus the observation by Radha with respect to the motion of the coffee.

what is the kinetic energy of a 7.26 kg bowling ball that is rolling at a speed of 2m/s

Answers

Answer:

14.52 J

Explanation:

The kinetic energy of an object can be found by using the formula

[tex]k = \frac{1}{2} m {v}^{2} \\ [/tex]

m is the mass

v is the velocity

From the question we have

[tex]k = \frac{1}{2} \times 7.26 \times {2}^{2} \\ = 2 \times 7.26[/tex]

We have the final answer as

14.52 J

Hope this helps you

5. The measurement of the amount of friction a surface will generate is called the ___
of friction'


Do you guys know ?

Answers

Answer:

The meaurement of the amount of friction a surface will generate is called the coefficient of friction.

The measurement of the amount of friction a surface will generate is called the coefficient of friction.

The frictional force is a force that opposes the force between two objects in contact.

For a body on a smooth surface, friction between the body and the surface is known as the coefficient of friction.

The smaller the coefficient of friction, the more the object tends to slide on the surface.

Hence we can conclude that the measurement of the amount of friction a surface will generate is called the coefficient of friction.

Learn more here: https://brainly.com/question/189856

3. Can object going in different directions at the same
speed have the same velocity? Why or why not?

4. If 1 car is going faster than another traveling in the same
direction, can they have the same velocity? Why or why not?

15 points I need help please ???

Answers

Answer:

3/4.no because there going in diffrent directions

Explanation:

Which could be an example of a balanced force?
An asteroid moving at a constant speed through space
A box of dishes falling from a counter
A rocket taking off
O A car accelerating from a stop sign

Answers

Answer:

An  asteroid moving at a constant speed through space.

Explanation:

An example of a balanced force is; an asteroid moving at a constant speed through space.

A balanced force is a force that does not produce acceleration or cause motion of a stationary body. According to Newtons first law, a body continues in its state of rest or uniform motion unless it is acted upon by an unbalanced force.

The asteroid is moving at constant velocity because all the forces that act on it are balanced. Once it is acted upon by unbalanced forces, it will accelerate in obedience to Newton's first law.

Learn more:  https://brainly.com/question/2673886

if you weigh 88 N on the moon when the gravity 1.6m/s2 what is your mass

Answers

Fg = mg

Fg = (Mass (kg)) x (acceleration due to Gravity (m/s2)).

Fg = (88N) x (1.6m/s2)

Fg = 140.8

Two skaters stand facing each other. One skater's mass is 60 kg, and the other's
mass is 75 kg. The two skaters push off each other. After the push, the smaller
skater has a velocity of 3.0 m/s. If no other forces are acting on the skaters, what
is the velocity of the larger skater?

Answers

Answer:

v' = 2.4 m/s

Explanation:

Given that,

Mass of one skater, m = 60 kg

Mass of the other's skater, m' = 60 kg

The two skaters push off each other. After the push, the smaller  skater has a velocity of 3.0 m/s.

When there is no external force acting on a system, the momentum remains conserved. It means initial momentum is equal to the final momentum. Let v' is the velocity of the larger skater.

mv = m'v'

[tex]v'=\dfrac{mv}{m'}\\\\v'=\dfrac{60\times 3}{75}\\\\v'=2.4\ m/s[/tex]

So, the velocity of the larger skater is 2.4 m/s.

Anyone please help me with this ???I need help with question a,c,d, and e ???ASAP 12 points

Answers

A-the boy exerting 500 N to the right direction
The rope exerting 500N to to left
C- 0
D- no he won’t
E- the net force will change, and the boy will be able to pull the rope more with the wall
Because there will be no opposite force on the gauge to cancel the one the boy is exerting

It takes me 12s to lift a box upward with 20 N of force to a height of 45m. What was my power output ?

Answers

Answer:

75Watts

Explanation:

Given parameters:

Time  = 12s

Force applied  = 20N

Height  = 45m

Unknown:

Power output  = ?

Solution:

Power is defined as the rate at which work is done.

 It is mathematically expressed as;

        Power  = [tex]\frac{work done}{time}[/tex]

Work done  = force x distance  = 20 x 45  = 900J

        Power  = [tex]\frac{900}{12}[/tex]   = 75Watts

What characteristics consider as consider as foundation of an effective officiating official?

A competence
B compassion
C confidence
D courage

Answers

Answer:

c

Explanation:

An airplane accelerates down a runway at 3.20 ms for 32.8 seconds until it finally lifts off the ground determine the distance traveled before takeoff

Answers

Answer:

105 meters.

Explanation:

If the airplane moves with the speed of 3.20 m/s for 32.8 seconds on the ground before takeoff, it covers 105 meters distance on the ground. We can calculate the distance by using the formula of speed which is speed is equal to distance divided by total time taken. We have to remove time present below the distance so for that we have to cross multiply and we get distance equal to speed x time. So by putting the values of speed and time we get our answer.

Other Questions
HELP ME PLEASE THIS IS FOR A GRADE AND THIS IS ALL I NEED!!! Can anyone help answer this? Besides organic pollutants, dead zones are also affected by nitrogen compounds. Denitrifying bacteria in the anoxic dead zones can use nitrates and nitrites as electron acceptors, thereby generating nitrous oxide, a potent greenhouse gas. What is the term used for this process?a. assimilatory nitrogen reductionb. dissimilatory nitrogen reductionc. nitrificationd. nitrogen fixation Which sequence could be partially defined by the recursive f (n + 1) = f(n) + 2.5 for n > 1? Use the Distributive Property to simplify the expression. 10(4-w)=HELP PLZ!!!!!! will give brainliest!hA class conducts a survey about types of movies. 53 girls and 48 boys reported comedy as their favorite. 23 girls and 62 boys reported horror as their favorite. Find the probability of a boy from this school selecting horror as his favorite type of movie Help me what is the slope of the line how the different occupation help our society? Makayla and Ember went shopping for OD gear and spent $262.00. If the tax rate is 5%, what is Makayla and Embers total after tax?$267.00$1,310.00$275.10$13.10 3. What are some of the differences between the Roman Republic and thegovernment of the United States? Write the ratio 7 : 4 in the form n : 1 pleaseee help me will mark brainliest Which is an example of a high-risk behavior that increases the likelihood of contracting an STI?a)using a public restroomb)having multiple sexual partners c)sharing a glass of waterd)holding hands with a partner reasons why would people be against voluntary assisted dying Suppose y varies directly as x. If y = 30 when x = 8, find y when x = 4. 1 + 1 I'm confusedddddddddddddddddddddddddddddddddddddddddd 3 + 2y = 143 - 2y = 10 Please help me w the equation and please dont take advantage of the points. Help I'm confused!This is the beginning sequence of the first exon in the mRNA sequence:AUGAAGCUCUUUUGGUUGCUUUUCACCAUUGive the DNA/genomic sequence it was transcribed from. is this correct? answer plz!!