Choose the combination of factors that creates snow.

Answer:

A windy weather

Explanation:

Tree will began to swayed

Answer:

A. Transcription

Explanation:

Transcription comes first in the process of protein synthesis.

Answer:

A.Transcription

Explanation:

Transcription is the process of making an RNA copy of a gene sequence. This copy, called a messenger RNA (mRNA) molecule, leaves the cell nucleus and enters the cytoplasm, where it directs the synthesis of the protein, which it encodes.

Answer: The last one im pretty sure.

Explanation:

CAN u pLZZ help me anwser my question

Explanation:

i hope this helps you ok like

The correct answer is B) an organism that feeds on dead matter.

A scavenger is an organism that obtains its food by consuming dead or decaying organic matter.

These organisms play a crucial role in ecosystems by recycling nutrients and breaking down organic material that would otherwise accumulate.

Scavengers are often attracted to carcasses or decaying organic material, where they feed on the remains of dead plants or animals.

Scavengers can include a variety of organisms from different taxonomic groups, such as vultures, hyenas, flies, beetles, and certain species of bacteria and fungi. They have adaptations that allow them to consume and digest dead matter efficiently.

By consuming dead organic material, scavengers help in the decomposition process, returning nutrients to the ecosystem and maintaining ecological balance. They prevent the accumulation of dead matter, which can lead to the spread of diseases and the release of harmful substances.

In contrast to the other options, which describe different ecological roles or processes, option B accurately characterizes the feeding behavior and ecological role of scavengers in consuming dead matter as a source of nutrition.

Therefore, the correct answer is B.

For more such answers on scavenger

https://brainly.com/question/259333

#SPJ8

Answer:

a. decomposers

Explanation:

Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.

Answer:

A .Weather

Explanation:

The state of atmosphere over an area at any point of time is known as weather. It is the state of the atmosphere over short periods of time. ... Precipitation, humidity, temperature, pressure, cloudiness, and wind are the basic atmospheric conditions that make up the weather of a region.

Answer:

BACE2 cuts both beta-amyloid and beta-amyloid precursor protein.

Explanation:

What makes BACE2 so effective in fighting Alzheimer's is its efficiency in cutting both beta-amyloid and the protein that develops it. There are other enzymes, which have the ability to break down beta-amyloid, but BACE2 is the only one that breaks it down into such small pieces that it completely destroys it. Furthermore, BACE2 is able to break down the beta-amyloid precursor protein, which prevents the formation of beta-amyloid from taking place.

Answer:

A. map

Explanation:

DNA acts as a map for living things.

Answer:

lods ayarn na:)

Explanation:

The four classes of biological macromolecules are (1) Proteins, (2) Lipids, (3) Carbohydrates, (4) Nucleic Acids.

Proteins are made up of amino acids linked by peptide bonds. They have multiple functions, depending on the number of amino acids and its specific sequence. They serve as major workers composing motor and structural elements in the cell. They can also function as catalytic proteins (enzymes), as well as helpers for storage, signal, transport, reception, defensive, and contractile tasks.

Lipids are made up of fatty acids (a carboxylic acid with a hydrocarbon chain + terminal carboxyl group) and glycerols (organic compound made up of multiple hydroxyl groups). They are a hydrophobic compound that are used for energy storage, thermal insulation, protection, and chemical messengers. Lipids also regulate membrane permeability and aid in fat soluble vitamin production.

Carbohydrates are made up of monosaccharides which build up a polysaccharide (carbohydrates). Monosaccharides are basic sugars which cannot be broken down anymore by water (glucose, fructose, galactose). Carbohydrates' major functions include energy provision, blood glucose regulation, biological processes recognition, and breakdown of fatty acids for ketosis prevention.

Nucleic acids are made up of nucleotides which are organic molecules that forms the Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA). Their structure consists of a nitrogenous base, pentose, and an attached phosphate group. The function of nucleic acids are the creation and storage of genetic information.

Conchoidal fracture in minerals creates a smooth, [tex]\sf\purple{curved}[/tex] surface that is similar to the surface of a conch or seashell.

[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Happy\:learning.}}}}}∘[/tex]

Answer:

A. Gametes

hope it is helpful to you ☺️

Answer:

a)

Explanation:

je suis ask teacher

Answer:

A. wheter the producers are located on land or in the water.

Answer:

a

Explanation:

just did it

Answer:

the answer should be "B"

Answer:

c information storage

Explanation:

information is stored in dna which provides the instructions required to make proteins . proteins do not store information

Answer:

B. out of the nucleus, into the cytoplasm where a ribosome will attach to it.

Explanation:

Once mRNA is made, it travels out of the nucleus, into the cytoplasm where a ribosome will attach to it.

Answer:

bro ineed help to

Explanation:

Answer:

option 1 is the crt answer

Explanation:

B and j show more dna similarity as B is the direct ancestor of j

Answer:

messenger RNA (mRNA)

Explanation:

mRNA or messenger RNA is one of the three types of RNA molecules (the other being tRNA and rRNA) that is specifically responsible for carrying genetic information previously encoded and stored in the DNA into the ribosomes for translation to occur.

The process of translation results to the synthesis of amino acid sequences, which make up a polypeptide. Hence, it can be said that mRNA is that type of RNA that acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide chain.

Answer:

Its either a or b

Explanation:

A say the body can make all of the compound its need

my suggestion compound are made up of water ,mineral protein carbs and fat

our body produce little nutrients so we need to eat to get the nutrients we need

im am going with b

B is the answer

Answer: Mental Labour, According to this definition, mental work refers to planning, organizing, coordinating, and managing duties and tasks that we perform during the course of our lives. People's worries about their ability to manage their time efficiently and effectively.

Explanation:

I explained at the top-

Answer:

Soil is a material made up of gases, organic substances, water, and microorganisms. This material may be used in building a roadbed and is often referred to as dirt. In comparison, a soil is a natural body that is three-dimensional much like a lake or mountain.

Explanation:

Hope this helps

Gases, organic materials, water, and microbes are all components of soil. This substance, which is frequently referred to as dirt, can be utilized to construct a roadbed. In contrast, the soil is a three-dimensional natural structure similar to a lake or a mountain.

This is how natural soil is different from the material used in constructing roadbeds.

Learn more about soil erosion here:

https://brainly.com/question/17905503

#SPJ2

Answer:

i think its B hope it helps

Explanation:

Adaptations are the alteration that allows the survival of the fittest. The adapted structure of the cacti allows it to take the minerals from the soil and prevents water loss. Thus, options A and B are correct.

Adaptation is seen as the modified physical and chemical characteristics that allow the organism to survive in stressful conditions. A cactus has adapted spines, roots, waxy skin, and deep-layered stomata.

These adaptation has allowed the cactus to survive the harsh conditions of dessert. The wide fibrous roots allow it to draw nutrients and minerals from the soil.

The thick, expandable stem with deep-layered stomata prevents the loss of water from the surface in high-temperature conditions and keeps the plant hydrated.

Therefore, options A and B. the adapted attributes of cacti prevent water loss.

Learn more about adaptations here:

https://brainly.com/question/12501143

#SPJ5

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

Answer:

ok

i can help you ..............

Explanation:

drop in the air pressure objects small mammals and insects in many ways mice and mouse are good weather indicators people who spend a lot of time outdoor have obeserved that field mice come out there holes squeak and run around before a storms appearce.

Answer:

The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).

Answer:

photo synthesis is the green plants which making other organisms to convert engry into chemical

Answer:

c wolves would be your Excellent answer

Answer:

D. birds

Explanation:

Fossils show that some of those extinct organisms evolved into organisms that survived today like birds.

Answer:

To produce natural oils for the skin

Explanation:

The normal function of sebaceous glands is to produce and secrete sebum, a group of complex oils including triglycerides and fatty acid breakdown products, wax esters, squalene, cholesterol esters and cholesterol.

Sebum lubricates the skin to protect against friction and makes it more impervious to moisture