Ethanol (C2H5OH) melts at –114 °C and boils at 78 °C. The enthalpy of fusion of ethanol is 5.02 kJ/mol, and its enthalpy of vaporization is 38.56 kJ/mol. The specific heats of solid and liquid ethanol are 0.97 J/g-K and 2.3 J/g-K, respectively. The average specific heat of gaseous ethanol is about 1.80 J/g-K. a. How much heat is required to convert 35.0 g of ethanol at 27 °C to the vapor phase at 120 °C? b. How much heat is required to convert the same amount of ethanol at –120 °C to the vapor phase at 120 °C?

Answers

Answer 1

Answer:

First question

       [tex]Q = 36826 \ J[/tex]

Second  question  

       [tex]Q = 52299.7 \ J[/tex]

Explanation:

From the question we are told that

     The melting point of Ethanol is  [tex]T_m = -114 ^oC[/tex]

      The boiling point of Ethanol is  [tex]T_b = 78^ oC[/tex]

       The enthalpy of fusion of Ethanol is [tex]F = 5.02 \ kJ / mol = 5.02 *10^{3}\ kJ / mol[/tex]

        The enthalpy of vaporization  of Ethanol is [tex]L = 38.56 \ kJ / mol = 38.56 *10^{3} \ J / mol[/tex]

         The specific heat of solid Ethanol is  [tex]c_e = 0.97 \ J/ g \cdot K[/tex]

          The specific heat of liquid  Ethanol is [tex]c_l = 2.3 \ J / g \cdot K[/tex]

           The mass of the Ethanol given is  [tex]m = 35.0 \ g[/tex]

Considering the first question

           The initial  temperature is [tex]T_i = 27^oC[/tex]

             The final  temperature is  [tex]T_f = 120^oC[/tex]

Generally the heat required too raise the Ethanol to its boiling point is mathematically represented as

       [tex]Q_1 = m * c_l * (T_b - T_i)[/tex]

=>      [tex]Q_1 = 35.0 * 2.3 * ( 78 - 27)[/tex]

=>      [tex]Q_1 =4106 \ J[/tex]

Genially the number of moles of Ethanol given is mathematically represented as

         [tex]n = \frac{m}{Z}[/tex]

Here Z  is the molar mass of Ethanol  with value  [tex]Z = 46 g/mol[/tex]

So

         [tex]n = \frac{35}{46 }[/tex]

=>      [tex]n = 0.7609 \ mol[/tex]

Generally the heat of vaporization of the Ethanol is mathematically represented as

         [tex]Q_2 = n * L[/tex]

=>        [tex]Q_2 =0.7809 * 38.56 * 10^{3}[/tex]

=>        [tex]Q_2 =29339 \ J[/tex]

Generally the heat required too raise the Ethanol from  its boiling point to  [tex]T_f[/tex]  is  mathematically represented as

       [tex]Q_3 = m * c_l * (T_f - T_b)[/tex]

=>     [tex]Q_3 = 35 * 2.3 * (120 - 78 )[/tex]

=>     [tex]Q_3 = 3381 \ J[/tex]

Generally the total heat required is  

     [tex]Q = Q_1 + Q_2 + Q_3[/tex]

=>   [tex]Q = 4106 + 29339 + 3381[/tex]

=>   [tex]Q = 36826 \ J[/tex]

Considering the second question

           The initial  temperature is [tex]T_i = -120^oC[/tex]

             The final  temperature is  [tex]T_f = 120^oC[/tex]

Generally the heat required too raise the Ethanol to its melting  point is mathematically represented as

       [tex]Q_1 = m * c_e * (T_m - T_i)[/tex]

=>      [tex]Q_1 = 35.0 * 0.97 * ( -114 - (- 120) )[/tex]

=>      [tex]Q_1 = 203.7 \ J[/tex]

Generally the heat of fusion  of the Ethanol is mathematically represented as

                 [tex]Q_2 = n * F[/tex]

=>        [tex]Q_2 =0.7809 * 5.02 *10^{3}[/tex]

=>        [tex]Q_2 =3920 \ J[/tex]

Generally the heat required too raise the Ethanol to its boiling point is mathematically represented as

       [tex]Q_3 = m * c_l * (T_b - T_m)[/tex]

=>      [tex]Q_3 = 35.0 * 2.3 * ( 78 - (- 114) )[/tex]

=>      [tex]Q_3 =15456 \ J[/tex]

Generally the heat of vaporization of the Ethanol is mathematically represented as

         [tex]Q_4 = n * L[/tex]

=>        [tex]Q_4 =0.7809 * 38.56 * 10^{3}[/tex]

=>        [tex]Q_4 =29339 \ J[/tex]

Generally the heat required too raise the Ethanol from  its boiling point to  [tex]T_f[/tex]  is  mathematically represented as

       [tex]Q_5 = m * c_l * (T_f - T_b)[/tex]

=>     [tex]Q_5 = 35 * 2.3 * (120 - 78 )[/tex]

=>     [tex]Q_5 = 3381 \ J[/tex]

Generally the total heat required is  

     [tex]Q = Q_1 + Q_2 + Q_3+Q_4 + Q_5[/tex]

=>   [tex]Q = 203.7 + 3920 + 15456 +29339+3381[/tex]

=>   [tex]Q = 52299.7 \ J[/tex]


Related Questions

a flask of 0.30 L was weighted after it had been evacuated.It was then filled with a gas of unknown molecular mass at 760 mm of Hg and temperature of 300 K. The increase in mass of flask was found to be 0.997 g. Determine the molecular mass​

Answers

The molecular mass​ : 81.72 g/mol

Further explanation

In general, the gas equation can be written  

[tex]\large {\boxed {\bold {PV = nRT}}}[/tex]

where  

P = pressure, atm , N/m²

V = volume, liter  

n = number of moles  

R = gas constant = 0.082 l.atm / mol K (P= atm, v= liter),or 8,314 J/mol K (P=Pa or N/m2, v= m³)

T = temperature, Kelvin  

P = 760 mmHg=1 atm

T = 300 K

V = 0.3 L

Number of moles :

[tex]\tt n=\dfrac{PV}{RT}\\\\n=\dfrac{1\times 0.3}{0.082\times 300}\\\\n=0.0122[/tex]

The molecular mass (MW) :

[tex]\tt MW=\dfrac{mass}{n}\\\\MW=\dfrac{0.997~g}{0.0122}\\\\MW=81.72~g/mol[/tex]

the force that holds paticles together in the atomic nuecleaus?

Answers

Explanation:

i believe you meant particles*

Which will diffuse the most? The particles with the
A. Least potential energy.
B. Most potential energy.
C. Least kinetic energy.
D. Most kinetic energy.

Answers

Answer:

B. Most potential energy

Explanation:

brainest plz

If you have 2.0 moles of sodium chloride (NaCl), what is its mass in grams?

Answers

Answer:

117g

Explanation:

Given parameters:

Number of moles = 2moles

Unknown:

Mass of NaCl  = ?

Solution:

To solve the problem, we need to use the expression below;

    Mass of NaCl  = number of moles x molar mass

Molar mass of NaCl  = 23 + 35.5  = 58.5g/mol

 

So;

Insert the parameters and solve;

     Mass of NaCl  = 2 x 58.5  = 117g

You have discovered an element that is a poor conductor of electricity, has a low melting point, and is a gas at room temperature. How would you classify this element?


A.metal

B.metalloid

C.actinoid

D.nonmetal

Answers

AHHH ITS B SORRY I ACTUALLY KNOE THIS

How many grams are in 7.5 moles of C6H12?



Group of answer choices

0.09g

630g

11.2

84g

Answers

Answer:

630gC₆H₁₂

Explanation:

How many grams are in 7.5 moles of C₆H₁₂?

C₆:12.011×6=72.066

H₁₂:1.008×12=12.096

72.066+12.096=84.162

84.162g/mol C₆H₁₂

7.5 molC₆H₁₂ ×84.162g/molC₆H₁₂= 631.215gC₆H₁₂

A nitrogen molecule (N2) has one triple bond. How many electrons do the nitrogen atoms share?

A. 1
B. 3
C. 4
D. 6

Answers

Answer:

3 electrons

Explanation:

DRAW A PEDIGREE

Read the following information and ON NOTEBOOK PAPER, construct a pedigree using the symbols we went over Tuesday: Scott is married to Christa. They have 3 children, Blake (a son), Peyton (a daughter), and Ashton (a daughter). Blake is married to Allie and they have 2 children, Henry (a son) and Harper (a daughter).

When you have completed your pedigree drawing, take a picture and attach it to this assignment and submit.

Answers

Answer:

Here you go

Explanation:

Help me please:(:(:( with my bellwork
for brainiest

Answers

Answer:

Elements are made of only one kind of atom

Compounds are made of 2 or more elements chemically bonded together

Explanation:

Its right there????

Are the atoms really "sharing" electrons

Answers

No they are donating them

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

Someone please help will mark as brainliest

Answers

1. solute is the substance that is being dissolve,while solvent is dissolving medium

2.saturated is solution that contain maximum amount of solut that capable of being dissolve and supersaturated is solution that contain less amount or medium of solut that capable being dissolve : example vinger

3. is a number placed in front of a chemical symbol or formula. It shows how many atoms or molecules of the substance are involved in the reaction. For example, two molecules of hydrogen would be written as 2 H2, and two molecules of water would be written 2 H2O . yes it's can be change only in caseWhen you balance an equation you can only change the coefficients

HELPPPPPPPPPPPPPPPPPPP

Answers

Answer:

not sure about the first one, but i know SDS provides information about the last 3.

Explanation:

Someone please help will mark as brainliest

Answers

Answer:

a1

The main difference between SPECT and PET scans is the type of radiotracers used. While SPECT scans measure gamma rays, the decay of the radiotracers used with PET scans produce small particles called positrons. A positron is a particle with roughly the same mass as an electron but oppositely charged.

Explanation:

a2

While imaging tests such as X-rays can show what the structures inside your body look like, a SPECT scan produces images that show how your organs work. For instance, a SPECT scan can show how blood flows to your heart or what areas of your brain are more active or less active.

a3

PET and SPECT have been extensively evaluated as diagnostic procedures for dementia. Substantial progress has been made in developing radioligands that bind to amyloid deposits in the brain, which should provide new opportunities for early diagnosis and treatment monitoring in Alzheimer's disease

a4

What are the disadvantages of spect as compared to pet?

However, SPECT has issues, including long scan times and low-resolution images prone to artifacts and attenuation. Some artifacts can easily be misidentified as perfusion defects. SPECT also does not provide a quantifiable estimate of the blood flow, whereas PET does, experts say.

How much oxygen (O) is in 5.41 × 106 atoms of oxygen

Answers

Answer:

They show you  how to do it sweetie

Explanation:

123456789 Common math

Can farmers simply plant more acres of crops to feed a growing population?

Answers

Answer:

I believe they can if it's a small town/village

Explanation:

how to find the electron in an atom/element

Answers

Answer:

to find the number of electrons an element has locate it on the periodic table of elements find the atomic number and note the number of protons because they are naturally electrically neutral

Answer:

M-A=N

Explanation:

M-A=N

Here is an example.

The equation above means that the atomic number (A) subtracted from the average atomic mass (M) equals the combined amount of neutrons and protons. Since we know that 35 17Cl is Chlorine (this is because Chlorine (Cl) is the 17th number on the periodic table and has the average atomic mass of 35), we can insert our data into the equation and end up with the following:

35-17=18.

From here, we can tell that we have a mix of neutrons and protons, with the total being 18. Since the atomic number is 17, we can reasonably assume that there are 17 protons and 1 neutron.

But we still need to find the number of electrons. Fortunately, the number of electrons is always equivilant to the number of protons and the atomic mass, so we know that the number of electrons is 17.

So, we have;

17 Protons

1 Neutron

17 Electrons

why is a rise in sea level significant?

Answers

Answer:

I honestly dont know but its cool problably from water fill or from the waves going to much

Explanation:

the answer I can think of is it might be the way the water has waves and it moves a lot

A sound wave moves from a solid material into a liquid. What would happen to the frequency of the sound?

Answers

The frequency of the sound waves travel faster and more effectively in liquids than in air and travel even more effectively in solids.

Explain why the electron configuration of 2-3-1 represents an atom in an excited state?

Answers

Answer:

See explanation

Explanation:

If we look at the electron configuration closely, we will discover that the element must have had a ground state electron configuration of 2,4.

This is because, the innermost shell usually holds two electrons while the outer shells hold eight electrons each. The four electrons must be accommodated in the second shell in the ground state configuration of the compound.

However, when the atom is excited, one electron from this shell may move to the third shell to give the excited state configuration 2-3-1 as shown in the question.

explain how to separate sugar from supersaturated sugar solution
guys pls help

Answers

A “supersaturated” solution contains more dissolved material. supersaturated solutions lies in the temperature of the water. more sugar will dissolve in hot water than in cold. Meaning that by separating the 2, only the supersaturated sugar would dissolve leaving the regular sugar untouched.

How many molecules are equal to 3.25 moles of carbon dioxide?

Answers

Answer:

1.957 × 10²⁴ molecules

Explanation:

The number of carbon dioxide molecules can be found by using the formula

N = n × L

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 3.25 × 6.02 × 10²³

We have the final answer as

1.957 × 10²⁴ molecules

Hope this helps you

Susan is investigating physical changes. To do this, she places some ice into a large bowl and seals it with a lid. She leaves the bowl on the counter for several hours until all of the ice has melted. Using a balance, Susan determines that the mass of both the water and the ice are equal. Why is the mass of the ice and the water the same? (SC.8.P.9.1)

Answers

Answer:

No mass loss

Explanation:

The mass of ice and the water in the different state are equal because the same of quantity of matter is present in both state of matter of matter.

In essence, the mass of the physical change process is conserved. When mass is conserved, matter is neither created nor destroyed but can be changed from one form to the other. This is in compliance with the law of conservation of matter. So, no mass was lost in the physical change process and the mass will remain the same.

Given a balanced chemical equation it is always possible to determine
A)
the physical state of the products and reactants
B)
whether a reaction will or will not take place
C)
the relative number of moles taking part in the reaction
D)
the conditions necessary for the reaction to take place

Answers

Answer:

C)  the relative number of moles taking part in the reaction

Explanation:

From a balanced chemical equation, it is always possible to determine the relative number of moles taking part in a chemical reaction.

The number of moles is the amount of the reacting specie that makes up a chemical reaction.

In balanced chemical equation, the number of moles of reactants and products must be the same. From this understanding, we can determine the amount of reactants and products needed for a chemical reaction to take place.

5. Which of the following elements will have a charge of 4+ or 4- as an ion?

Answers

Answer:

The answer would either be Carbon or Silicon.

Explanation:

How to we measure energy?

Answers

Answer:

The official measurement unit for energy is the Joule (J). Among the most common units measuring energy mention should be made of the kilowatt/hour (kWh), used especially for electric energy (in fact it is used to calculate electricity bills).

With joules hope I helped

How can magnetic force be exerted on objects?

1)Over a distance and anytime an object is in a magnet's field of influence.

2)Only through objects.

3)Only by touching an object.

Answers

I think the answer is : 1

Which of the following is an intensive property?

Mass
Magnetism
Shape
Volume

Answers

Answer:

I believe its A. Mass

Explanation:

An intensive property is a property of matter that depends only on the type of matter in a sample and not on the amount. For example, the electrical conductivity of a pure substance is a property that depends only on the type of substance. Silver, gold, and copper are excellent conductors of electricity, while glass and plastic are poor conductors.. Other intensive properties include color, temperature, density, and solubility.

Answer:

B. Magnetism

Explanation:

Hope this helps! :))
Sorry for late answer

What is a mixture of sugar and water?

a solution

molecule

a compound

a precipitate

Answers

Explanation:

I think its a solution just me tell me in comments if right

Answer:

A solution

Explanation:

Sugar is soluble in water and would dissolve into the water to form a solution.

The chemical equation describing the burning of hydrogen gas is: 2H2 + O2 ---> 2H2O.
Why is this both a synthesis and a combustion reaction?

Answers

Answer:

"A combustion reaction is a reaction in which a substance reacts with oxygen gas, releasing energy in the form of light and heat. Combustion reactions must involve O2 as one reactant. The combustion of hydrogen gas produces water vapor." and "A synthesis reaction occurs when two or more reactants combine to form a single product. ... In a double replacement reaction, two compounds exchange elements. A combustion reaction occurs when a substance reacts quickly with oxygen. Combustion is commonly called burning"

Explanation:

I tried

Other Questions
7(1 - y) = -3(y - 2) A person studying economics chooses to buy an economic textbook for their class, even though it means theycannot afford to buy a video game they want. This shows an understanding ofO goods.O services.O production.consequences and tradeoffs. Write the equation y = mx + b of a line given two points.Ex 1.(3,3) and (4,-2)Ex 2. (4,1) and (6,2) Please help!!!! Thank youuu Ill make brainlisy Macroeconomics is the study of economics on a very small scale 10 POINTS!!!! for the most meaningful message along with a Brainliest #3) Find the equation of the linear relationship represented in the table below.x-7.5-311-35-7 PLEASE HELP! 10 Points!! She likes to eat vegetables but she does not like to eat spinach. Is this a complex or compound sentence? Who was the major leader of the British troops at Yorktown Which of these was known as one of the greats in blues?A. Luis ArmstrongB. Bessie SmithC. John ZornD. Duke Ellington What inference can logically be made about prsperos brother Antonio based on the events described in the passage What are you most thankful for this year? 6Select the correct answerWhich intervention DECREASES the likelihood that a behavior will happen again?OANegative reinforcement,Positive reinforcementOC. PunishmentODNone of the aboveResetNel HELP! Mylo started making this graph to relate the number of hours he works with the amount of money he is paid.A point representing which information could be added to the graph to show a proportional relationship? A. $16 for working 2 hours B. $36 for working 4 hours C. $40 for working 5 hours D. $58 for working 6 hours please answer to the above question Alonso paid for repairs on his car, and 35 of the bill was for labor costs. How much was the total bill if the cost of the labor was $79.50? Let b = the amount of the total bill.Which equation and solution is correct?Five-thirds b = 79.50, and the total bill was $47.70.Three-fifths (79.50) = b, and the total bill was $127.20.Five-thirds b = 79.50, and the total bill was $212.00.Three-fifths (b) = 79.50, and the total bill was $132.50. Practice Labeling the Cell. Label the parts of each cell. In at least 150 words, explain the motivation of Jerrys mother in "Through the Tunnel" and how her motivation advances the plot of the short story. Which is a ready-to-eat food?O A. Cookie doughO B. Lamb chopsO C. Frosted cupcakesOD. Russet potatoes