is x=-2 linear or nonlinear

Answers

Answer 1

Answer:

non linear

Step-by-step explanation:

Answer 2

Answer: I'd say linear

Step-by-step explanation:Because it is a straight line vertically on the x-axis -2


Related Questions

please HELP I WILL GIVE BRAINLIEST

Answers

1/3 so sorry if this is wrong

Coloca verdadero (V) o falso (F) donde corresponda: I. La moda de: 3; 3; 5; 6; 6; 3; 8; 9 es 3 II. La mediana de: 25; 23; 16; 14; 5; 1; 13 es 14. III. La media aritmética de: 8; 6; 7; 6; 5; 4; 3; 1 es 6

Answers

Dnskkdkskslsksnsnsjz

Micah and Joel each have a set of five rational numbers. Although their sets are not the same, their sets of numbers have absolute values that are the same. Show an example of what Micah and Joel could have for numbers. Give the sets in order and the absolute values in order.

Answers

Solution :

Ordering numbers means we have to arrange the numbers in ascending order or in a descending order i.e. from small value to big or from big value to small value.

The order of the positive numbers is same as the order of the absolute values and their order of the negative numbers are opposite to the order of their absolute values.

In the context, if Micah is having numbers 1, 2, 3, 4, 5, then the order of the absolute values of the numbers would be 1, 2, 3, 4, 5. Similarly, if Joe is having numbers -5, -4, -3, -2, -1, then the order of their absolute value will be also 1, 2, 3, 4, 5.

And if Micah have the numbers -5, -3, -1, 2, 4, then the absolute values of his numbers is 1, 2, 3, 4, 5. Also if Joe have numbers as -4, -2, 1, 3, 5, then his order of absolute values is also 1, 2, 3, 4, 5.

2 3 + 6^{2} ÷ 9 i need help with this one

Answers

Answer: 7

Step-by-step explanation:

3+6^(2) / 9

3 + 36 / 9

3   +   4

    7

A ratio is a comparison of two quantities. For example, the ratio of cows to pigs on a farm could be 1 to 3. For every 1 cow, there are 3 pigs. The ratio of chocolate chips to raisins in a cookie could be 5 to 9. For every 5 chocolate chips in the cookie, there are 9 raisins. Do you notice a repeating phrase in these examples? “For every” is key ratio language. It tells you how much of one quantity exists in comparison to the other quantity. A ratio consists of just the numbers, not the units. If someone asked the ratio of chocolate chips to raisins in the cookie example, you’d say 5 to 9.

Answers

Answer:

How many diet sodas there are in the fridge compared to how many regular sodas?

Step-by-step explanation:

A ratio is a comparison of two quantities. You could represent how many diet sodas there compared to how many regular sodas as a ratio.

I think you were trying to ask about the Flocabulary question, right?

I had it too and got it correct.

Meg the Stallion placed 8 books on each shelf of a bookcase. If she shelves 32 books. How many shelves are needed?

Answers

Answer:

Meg thee Stallion would need to borrow 4 shelves from Cardi B

Answer:

4 shelves

Step-by-step explanation:

you can do 32 divided by 8 which gives you 4 or keep adding 8 until you get 32 and count how many times you had to add.

Tim is a first grader and reads 43 words per minute. Assuming he maintains the same rate, use the double number line to find how many words he can read in 5 minutes. Words 0 43 Minutes 0 1 Tim can read words in 5 minutes.
as a timeline

Answers

Answer:

all you have to do is Just divided the numbers

Step-by-step explanation:

÷

identify the angles that each have a measure of 88

Answers

Answer:

∠1=∠88(Vertically Opposite angles are equal)

∠8=∠88(corresponding angles are equal)

∠3=∠88(alternate interior angles are equal

Angles ∠1, ∠3 and ∠8 are equal to 88°.

What is angle?

An angle is the formed when two straight lines meet at one point, it is denoted by θ.

Angle 1 and 88 are the vertically opposite angle, so they are equal

∠1 = 88°

Angle 1 and angle 3 are corresponding angle, so they are equal

∠1 = ∠3 = 88°

Angle 3 and 8 angle are vertically opposite angle, so they are equal

∠3 =∠8  = 88°

Therefore, ∠1 = ∠3 = ∠8  = 88°

To learn more about Angle on:

https://brainly.com/question/28451077

#SPJ2

Which equation would generate the arithmetic sequence: -8.-3.2.7.12.

A 5-8(n-1)

B = -8+5(n-1)

C None of the other answers are correc

D = -8-5(1-1) a = 5+8(n-1)​

Answers

Answer: B

Step-by-step explanation:

The equation for an arithmetic sequence is:

aₙ = a₁ + d(n - 1)

This matches answer B, so lets test it.

Substitue the position values for n

Given: Position 1 = -8

Solve Position 2:

a₂ = -8 + 5(2 - 1) = -3

a₃ = -8 + 5(3 - 1) = 2

a₄ = -8 + 5(4 - 1) = 7

a₅ = -8 + 5(5 - 1) = 12

what’s 6/7 - 1/2? also how do i subtract fractions with unlike denominators? you don’t have to answer the 2nd question

Answers

Make this same denominator
6/7 * 2/2 = 12/14
1/2 * 7/7 = 7/14
Now subtract
12/14 - 7/14 = 5/14

6/7 - 1/2 equals 5/14.

Subtract the fractions: Now that the fractions have the same denominator, you can subtract them by subtracting the numerators while keeping the common denominator. In this case, subtracting 7/14 from 12/14 gives you 5/14.

To subtract fractions with unlike denominators, you need to find a common denominator for both fractions. The common denominator is the least common multiple (LCM) of the denominators. Once you have the common denominator, you can subtract the fractions by following these steps:

Find the LCM of the denominators: In this case, the denominators are 7 and 2. The LCM of 7 and 2 is 14.

Rewrite the fractions with the common denominator: To rewrite 6/7 and 1/2 with a common denominator of 14, you need to multiply both the numerator and denominator of each fraction by a suitable factor. For 6/7, you would multiply both numerator and denominator by 2 to get 12/14. For 1/2, you would multiply both numerator and denominator by 7 to get 7/14.

Subtract the fractions: Now that the fractions have the same denominator, you can subtract them by subtracting the numerators while keeping the common denominator. In this case, subtracting 7/14 from 12/14 gives you 5/14.

Therefore, 6/7 - 1/2 equals 5/14.

For more details of Subtract the fractions:

https://brainly.com/question/5220474

#SPJ6

Find the slope of the line.

On a coordinate plane, a line goes through (negative 1, 0) and (negative 1, 1).

a.
Undefined

c.
Three-halves

b.
0

d.
-1

Answers

Greetings.

A line goes through (-1,0) and (-1,1).

~ Theory ~

If both x-term for both ordered pairs have same value. The slope for line graph is undefined.

~ Proof ~

Using Rise/Run

[tex]m = \frac{1 - 0}{ - 1 - ( - 1)} \\ m = \frac{1}{ - 1 + 1} \\ m = \frac{1}{0} [/tex]

Because the denominator is 0, therefore, the slope is undefined.

Because from rise/run. We put the x-term to subtract another x-term. And if both x-terms have same value. It will give the run/denominator = 0.

Therefore the answer is a. Undefined

Answer:

I think the answer would be letter a

Step-by-step explanation:

Have a great day, hope I helped

Is the following a function? Each player’s jersey number paired with their age.

Answers

Answer:

Yes it is a function if the jersey numbers are the same as their age and they are all different ages.

Step-by-step explanation:

BRAINLIEST !!! 14. Find the length of the midsegment (NOT X)
88+40
16x
7

Answers

Answer:

Step-by-step explanation:

The length of the midsegment is  half of the base in this case.

12x = 8x + 40

4x=40

x=10

So it's 60

Answer:

60

Step-by-step explanation:

Please help! Very fast. Please be correct!

Answers

Answer:

1. true

2. true

3. false

4. true

5. true

i am beyond confused

Answers

It would be B because the angle of R is greater than the angle of S, and the angle of S is greater than the angle of T

Your answer would be B


(THIS IS A TEST I NEED HELP)
A flagpole casts a shadow that is 15 feet long. How tall is the
flagpole?
A 10ft
B 20ft
C 40ft
D 400ft

Answers

Answer:

i think its C

Step-by-step explanation:

Answer:

it's 20

.......: )...…...

A half game in football is 45 min. At one point, a half was extended so that it was 48 minutes 30 seconds long. By what percentage was the half extended? Round to the full percentage.

Answers

Answer:

8%

Step-by-step explanation:

Multiply the number 45 by at least 1 point 0 something and therefore.  We can assume that a 5% increase is around 47 minutes and 15 seconds and a 10% increase is around 49 minutes and 30 seconds ranging for you to use from 6% to 9%.  The exact answer for the increase is around 7.78%, for me, I would plug in the equation like 45*1.7 and 45*1.8 on the calculator for more accuracy since you would need to round to the full percentage if it's between 7.5% to the exact number, it would be fully rounded to 8% since you would need at least a 5 to round up.

Does the graph represent a function? Why or why not?
A. No, because it fails the horizontal line test.
B. Yes, because it passes the horizontal line test.
C. Yes, because it passes the vertical line test.
D. No, because it fails the vertical line test.

Answers

Answer:

D . No because it fails the vertical line test .

Step-by-step explanation:

It’s not a function bc it’s not in a vertical line

i need help for this pls

14+(−9)+(−9)

Answers

Answer:

the answer is -4. :)

Step-by-step explanation:

-4 this is the answer

(1/a-1 )+ 2a/1-a^2
Answer
Please show the steps

Answers

Answer:

boop boop beep bop

Step-by-step explanation:

Im nice heheh

roight?

How are maps of cities like dilations? GEOMETRY WILL GIVE BRANLIEST.

Answers

Dilations change the size of an object or image. In this case, a city map changes the city's size and makes it smaller so that it can be read.

Using the information given, write an equation in slope-intercept form.
9
7) m=
2
and b=3.

Answers

Answer:

y = 2x + 3

General Formulas and Concepts:

Algebra I

Slope-Intercept Form: y = mx + b

m - slope b - y-intercept

Step-by-step explanation:

Step 1: Define

Slope m = 2

y-intercept b = 3

Step 2: Write function

y = 2x + 3

Slope intercept form : y=mx+b

answer: y=2x+3

You’re basically supposed to substitute

joe spent $15. he bought 2 cans of oil. abouthow many gallons of gasoline did he buy

Answers

The expression that can be used to determine the total amount of Joe spent on gasoline and oil is 2.85g + 3.15c.

The number of gallons of gasoline he bought is 3.0 gallons.

How to find the expression to determine the total amount of gas bought?

Joe bought g gallons of gasoline for 2.85 dollars per gallons and c cans of oil 3.15 dollars per can.

Therefore, the expression that can be used to determine the total amount of Joe spent on gasoline and oil is as follows:

total amount = 2.85g + 3.15c

where

g = number of gallons of gasolinec = cans of oil

Joe spent 15 dollars . He bought 2 cans of oil . The amount of gallons of gasoline he bought can be calculated as follows:

15 = 2.85g + 2(3.15)

15 = 2.85g + 6.3

15 - 6.3 = 2.85g

8.7 = 2.85g

g = 8.7 / 2.85

g = 3.05263157895

Therefore,

g = 3.0 gallons of gasoline

learn more on expression here: brainly.com/question/29177553

#SPJ1

Which problem can be solved using the expression 1/3÷1/4 ?

Answers

Answer:

Step-by-step explanation:

Divide: 1

3 : 14 = 13 · 4 1 = 1 · 4 3 · 1 = 43

Dividing two fractions is the same as multiplying the first fraction by the reciprocal value of the second fraction. The first sub-step is to find the reciprocal (reverse the numerator and denominator, reciprocal of 1

4 is 4 1

) of the second fraction. Next, multiply the two numerators. Then, multiply the two denominators. In the next intermediate step the fraction result cannot be further simplified by canceling.

In words - one third divided by one quarter = four thirds.

Your bank account balance is −$52.85. You deposit $65.50. What is your new balance?

Answers

Answer:

$12.65

Step-by-step explanation:

Your balance will be 12.65

The three-dimensional figure below is a cylinder with a hole in the shape of a rectangular prism going through the center of it. The radius is 10 yards. Find the volume of the solid in cubic yards, rounded to the nearest ten.

Answers

Answer: 1,510

Step-by-step explanation: using the formula

(pie•r2•height) - (width•length•height)

I plugged in the numbers to get

(Pie•10(2)•5) - (4•3•5)

This gives you

1,570 - 60

= 1,510

Expand 4(-2y + 3).

-8y + 12
2y + 7
-8y + 3
2y + 12

Random Math because I'm too lazy time ¯\_(ツ)_/¯

Answers

-8y+12 you just multiply the 4 by the others

HELP PLEASE ASAP :))))

Answers

Answer:

ARITHMATICKS

Step-by-step explanation:

1. 139=M

2. 25=I

3. 30=T

4. 46=K

5. 516=R

6. 48=C

7. 78=S

8. 10=A

9. 39=H

Hope this helps! If you need equations, please tell me.

Mackenzie has a loyalty card good for a 20% discount at her local hardware store. What would her total in dollars and cents be, after the discount and before tax, if the total cost of all the items she wants to buy is $17.45? Round to the nearest cent.

Answers

Answer: $14.0

Step-by-step explanation:

For us to calculate this question, we have to find 20% of $17.45 and then subtract the value gotten from $17.45. This will be:

= $17.45 - (20% × $17.45)

= $17.45 - (0.2 × $17.45)

= $17.45 - $3.49

= $13.96

= $14.0 to nearest cent

Answer:

0.35

Step-by-step explanation:

Write 1.33 x 10^6 in standard notation

Answers

Answer:

14.098

Step-by-step explanation:

Other Questions
1. Use the following graph to determine the coordinated of the y-intercept.A. (5,0)B. (4,0)C. (0,4)D. (0,5)HURRY!!! Please. How does the theme that stories can help us understand oneanother develop in "The Speech"? 2 The density of a substance can be determinedby finding the unit rate that compares mass tovolume. A nugget of gold has a mass of463.2 grams and a volume of 24.0 milliliters.What is the density of gold?F 11,116.8 g/mLG 439.2 g/mLH 0.052 g/mLJ 19.3 g/mL Answer #1 and #2 for Brainliest! Plz answer if you know and not just for points Though Shaka was a great African leader he was unable to keep his kingdom intact against the superiorweapons of the British. The Zulus became part of British controlled land in 1887. Many of the whiteImperialists believed it was their duty to then convert natives to western cultural values. The discovery ofdiamonds and gold in southern Africa created a world rush to exploit fortunes from these products for thecolonizers. The legacy of this time period is complex. The mixing of cultures has led to new culturalgroups such as peoples in Mexico with indian and Spanish blood. Colonization also led to the rise of manyruthless military leaders who had little experience with democracy or human rights leaving many colonizedareas struggling in the modern age.Select the best word because the paragraph mentions African leaderAssimilationNatural rights/EnlightenmentEconomicsPolitics/ExecutiveNatural ResourcesConquistadors/Absolute powerWhite Man's BurdenIndirect ruleBud A medium pizza at Benny's Pizza costs $13.60 plus $2.50 for each topping. At Ricco'sPizza, a medium pizza costs $14.60 plus $2 for each topping. For how many toppingswill the pizzas cost the same price?O 2 toppingsO They will always cost the same. 1 toppingO They will never cost the same. Please help! 20 points and brainly!!Which ratio forms a proportion with 14/42? 1/4 7/21 12/40 28/80(Please explain how you got the answer) What are all the secrets to the universe ? 25. Which of these does natural selection work on?a. Only animalsb. All populationsc. Only microscopic organismd. Individualse. Only small The graph of a system of equations will intersect at exactly 1 point? PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT The corect phase sequence shownGas, Liguid, SolidLqud, Gas, SolidSold, Liguid, GasGas, Solid, Liquidabove i