Lydia ran 10 miles in 120 minutes how many did she ran per mile

Answers

Answer 1

Answer:

I think the answer would be 12

Answer 2

Answer:

12 minutes per mile

Sorry if I got it wrong


Related Questions

not a school question but how do i get more points lol

Answers

Answer questions. Duh
By answering other people’s questions! You can find ones based on subjects you’re good at!

Find the perimeter. Simplify your answer completely.

Answers

Answer:119 4/7

Step-by-step explanation:

2/14+6/14+2/14+4/14+1/14+3/14+4/14= 22/14

10+35+10+12+24+15+12=118

118 22/14

119 8/14

119 4/7

Answer:

119 and 4/7

Step-by-step explanation:

10 + 12 + 15 + 24 + 12 + 10 + 35 = 118.

3/14 + 1/14 = 2/7

1/7 + 2/7 + 2/7 + 2/7 = 1

1/7 + 3/7 = 4/7

118 + 1 + 4/7 = 119 and 4/7

You buy a new laptop for $300.
The sales tax is 6%.

What is the total cost for the laptop including the sales tax?


Answers

Answer:

$318

Step-by-step explanation:

since sales tax is 6%, multiply 300 by 1.06 to find the total cost

Answer:

use socratic it get my grades A+

n/-5=7 it is due today

Answers

Answer:

n = 35

Step-by-step explanation:

Answer:

n=35

Step-by-step explanation:

Solve for nn by simplifying both sides of the equation, then isolating the variable.

Do you love math?
Do you like math?​

Answers

Answer:

frickk math

Step-by-step explanation:

i will never use it

Choose the scenario that describes a proportional relationship O Miguel earns $7.50 per hour while babysitting O A hotel charges a flat rate of $12.00 to park in their parking lot. O A cellphone plan is $25 plus $0.05 per megabyte, MB, of data usage. O Raphael sells paintings for $200 each at a market, but has to pay $100 to reserve a table


if u answer and its right I help u out kay?​

Answers

Answer:

A hotel charges a flat rate of 12.00 to a park walk in their parking lot.

Step-by-step explanation:

mrs. O'Neill has 9/4 lb of strawberries if each batch of muffins requires 1/2 pound of strawberries how many batches of muffins can she make provide step by step directions ​

Answers

Answer:

1.125 or 9/8 batches of muffins

Step-by-step explanation:

m = 0.5s where m = the amount of muffins and s = the lb of strawberries

m = 0.5(2.25)

m = 1.125 or 9/8 batches of muffins

Answer:

4.5 batches

Step-by-step explanation:

1 batch = 1/2 poundsx  batches = 9/4 pounds

Cross-multiplication:

x*1/2 = 1*9/4x = 9/4*2x = 9/2x = 4.5 batches

i’ll give u brainliest What is the degree measure of x?

Answers

Answer:

134 is the ONLY correct answer

Step-by-step explanation:

This is because it is asking for X, not the interior angle that's missing. You do need that angle to find the correct answer.

All triangles are equal to 180 degrees.

180-88-46=46

And all supplementary angles are equal to 180 degrees.

Therefore, 180-46 (as that is the only known angle) makes it 134 degrees.

67, 88 are not correct as one of them isn't obtuse and the other isn't to scale, 111 isn't correct as the math backs up 134 which is also an obtuse angle

.

Ethan has saved $180 to buy a bicycle which costs $540. He wants to find out how much more he needs to save to buy bicycle. Which equation when solved would show Ethan the amount of money ne needs to save?

Answers

180 + x = 540
-180 = -180
X = 360

Janice left the mall with $13.42 she spent $42.89 on a pair of jeans $17.45 on a shirt and $28.93 on a purse how much money did Janice start with

Answers

Answer:

$89.27

Step-by-step explanation:

All you do is add all the money she spent.

Find the equation that can represent the situation if the sum of two numbers is 32. We also know that the greater number is 5 more than the smaller number. (5 points)

a
x + (x + 5) = 32

b
x − (x + 5) = 32

c
x(x + 5) = 32

d
x(x − 5) = 32

Answers

Answer:

A. x+(x+5)=32

Step-by-step explanation:

Solve the problem.
Kannanaski Rapids drops 70 ft vertically over a horizontal distance of 866 ft. What is
the slope of the rapids?
-0.001
-12.4
-70
-0.081
I need help ASAP :(

Answers

Answer:

0.081

Step-by-step explanation:

Given parameters:

Vertical drop  = 70ft

Horizontal distance  = 866ft

Unknown:

Slope of the rapids  =?

Solution:

Slope is the rise or vertical height divide by the horizonal distance.

  Slope  = [tex]\frac{vertical drop}{horizontal distance}[/tex]

  Insert the parameters and solve;

  Slope  = [tex]\frac{70}{866}[/tex]   = 0.081

Based on the information given the slope of the rapids is 0.081.

Slope of the rapids:

Using this formula

Slope of the rapids=Vertically rapid drop/Horizontal distance

Let plug in the formula

Slope of the rapids=70ft/866ft

Slope of the rapids=0.0808

Slope of the rapids=0.081 (Approximately)

Inconclusion the slope of the rapids is 0.081.

Learn more about slope of the rapids here:https://brainly.com/question/3493733

I need help plzzzzzz

Answers

Answer:

3>-3 (a)

Step-by-step explanation:

3 is greater than -3

Answer:

The Answer is A

Step-by-step explanation:

Hope this helps

On a 1 mile track, Runner A has made 18 laps in the time it took Runner B to make 8 laps. If Runner A is running 5 mph faster than Runner B, how fast is each of them running?

Answers

Answer:

Runner A is running at 9 mph while runner B is running at 4 mph

Step-by-step explanation:

From online values, 4 laps make 1 mile.

We are told Runner A has made 18 laps in the time it took Runner B to make 8 laps.

This means that runner A has run in mile; 18/4 = 4.5 miles

While runner B has run in miles; 8/4 = 2 miles

Runner A is running 5 mph faster than Runner B, thus speed of runner A is;

V_b + 5 while speed of runner B is V_b.

We know that; time = distance/speed

Thus;

t_a = 4.5/(V_b + 5)

t_b = 2/V_b

Since the times are equal from the question, then;

4.5/(V_b + 5) = 2/V_b

Cross multiply to get;

4.5V_b = 2(V_b + 5)

4.5V_b = 2V_b + 10

4.5V_b - 2V_b = 10

2.5V_b = 10

V_b = 10/2.5

V_b = 4 mph

Since V_a = V_b + 5

Thus, V_a = 4 + 5 = 9 mph

Runner A is running at 9 mph while runner B is running at 4 mph

PLEASE HELP ASAP!!!
1-4
I WILL MARK BRAINLIEST!!!
It’s due in 4 minutes!

Answers

Answer/Step-by-step explanation:

Recall that the length of the midsegment of a triangle, is half the length of the third side.

Let's find the following given midsegments as follows:

1. IH = ½*ZX

IH = ½*18

IH = 9

2. PQ = ½*JL

PQ = ½*4

PQ = 2

3. CD = ½*GI

CD = ½*22

CD = 11

4. LK = ½*QS

LK = ½*18

LK = 9

How do the number line graphs of the solutions sets of -23 > X and X2-23 differ?
One graph uses an open circle, but the other graph uses a closed circle. Also, the rays use arrows that point in
opposite directions, but they have the same endpoint.
They use arrows that point in opposite directions, the rays have different endpoints, and both graphs use open
circles.
O One graph uses an open circle, but the other graph uses a closed circle. Also, the rays have different endpoints, but
they use arrows that point in the same direction.
They use arrows that point in opposite directions, the rays have different endpoints, and both graphs use closed
circles.

Answers

Answer:

the answer is A. One graph uses an open circle, but the other graph uses a closed circle. Also, the rays use arrows that point in opposite directions, but they have the same endpoint.

Answer:

A as in apple

Step-by-step explanation:

which inequality is shown in the graph below?​

Answers

Answer:

Step-by-step explanation:

must be the equation

y > x+1

because the slope is 1 and is 1 abve the origin and a dotted line

Calculate the actual sales since the sales and sales tax were rung up together. Assume sales tax of 6% and total sales of $33,000.

Answers

Answer:

the actual sales be $31,132

Step-by-step explanation:

The computation of the actual sales is as follows:

Let us suppose the actual sales be x

Now the sales tax be 0.06x

Now the total sales would be

x + 0.06x = $33,000

1.06x = $33,000

x = $33,000 ÷ 1.06

= $31,132

hence, the actual sales be $31,132

The same is to be considered by applying the above equation

Answer:

actual sales be $31,132

Step-by-step explanation:


What is the width of a rectangle that has an area of 96 square inches and a length of 12 inches?

Answers

Answer:

width = 8

Step-by-step explanation:

to find the width of a rectangle you need to to the equation w= A ÷ l. when you put in the numbers you gets w = 96 ÷ 12.

96 ÷ 12 = 8 so w = 8

Answer:

The width is 8inches

Step-by-step explanation:

I used this question and it was right on my test.

Identify which of the following equations represent functions. Select all that apply.

Answers

Answer:

Step-by-step explanation:

Nothing to choose from.

However, to be a function the x can only be used once. It has to pass the vertical line test.

What is the equation of the line in slope-intercept form?

Line on a coordinate plane. Line runs through points begin ordered pair negative 3 comma 0 end ordered pair and begin ordered pair 0 comma 4.

Enter your answer in the boxes.

y =
x +

Answers

Answer: x= 3     y=0

x= 0        y=4

Step-by-step explanation: Because the x value is the first number like (3,0) in this 3 is the first number. Y is the second. HOPE IT HELPS!

Answer:

y= 4/3x+4

Step-by-step explanation:

hit me wit that brainliest

Which of these strategies would eliminate a variable in the system of equations?
( 10x + 4y = -2)
(5x-2y=2)
Choose all answers that apply:
Multiply the top equation by
then add the equations.
Multiply the bottom equation by 2. then subtract the bottom equation from the top equation.

Answers

finish the first answer.
and your case the third option would be the best choice to eliminate available in the system of equations because multiplying by two would cancel out

Solve absolute value inequality 4>|x+1|+2

Answers

Answer:

-3 < x <1

Step-by-step explanation:

4 > | x + 1 | + 2

1. Isolate the absolute value;

Inverse operations;

4 > | x + 1 | + 2

-2               -2

2 > | x + 1 |

2. Remove the absolute value;

The absolute value of a value is the distance it is from zero. This means that when removing the absolute value, one has to account for two possibilities; when the value within the absolute value brackets is negative, and when it is positive. In the case of dealing with absolute value inequalities, one will have to set up an inequality with this in mind.

2 > | x + 1 |

-2 < x + 1 < 2

Inverse operations

-2 < x + 1 < 2

-1                -1

-3 < x < 1

Answer:

-3<x<1

Step-by-step explanation:

there is a $50 fee to rent out a bouncy house plus $20 per hour write an equation that represents the total amount paid

Answers

50x + 20 = y

i did it random sry

Keagan earned $55.00. He spent 3/5 of it and saved the rest. How much money did he save?

Answers

Answer: He saved $22

Step-by-step explanation:

2/5 x 55 = 22

1st Answer:

$54.40

Step-by-step explanation:

3/5 = 0.60

55- 3/5 =

55 - 0.60 = 54.40

School lunches cost $87.75 for 5.4 weeks. About how much would the lunches cost per week?

Answers

Answer:

16.25

Step-by-step explanation:

divide money by the weeks .

The cost per week would be $87.75 / 5.4 weeks
87.75/5.4 = 16.25

That means the cost of lunch per week is $16.25

Simplify Expressions with distribution
Rewrite in simplest terms: –2(8d + 10f) – 7f - 10(-7f + 7d)

Answers

Step-by-step explanation:

–2(8d + 10f) – 7f - 10(-7f + 7d)

first parentheses (PEMDAS)

-2×8d=-16d

-2×10f=-20f

-10×-7f=70f

remember negative × negative = positive

-10 × 7d = -70d

-16d+(-20f)+(-7f)+70f+(-70d) =

-86d+43f

I hope I helped ! :)

First person with a answer is marked as the Brainliest answer

Answers

Answer:

8

Step-by-step explanation:

look at the graph

Answer:

8

Step-by-step explanation:

h(6) is the same as x = 6

all you have to do is find the y value on the line that corresponds with the x value

A club's first meeting was attended by 21 people. The second meeting was attended by 3 times as many people as the first meeting. How many people attended the second meeting?




anwser:



step by step example ​

Answers

Answer:

63 people

Step-by-step explanation:

first meeting 21 people

second meeting 3 time as many people as first meeting

so 21 ×3=63

i just try it..

Answer:

twenty one multiplied by three to get sixty three which is the answer

At Baceball practice, Asher caught 16 of 20 hits to the out field. Select all of the was of expressing 16 out of 20. a. 3/5 b. 0.8 c.80% d.0.08

Answers

Answer:

16 : 20 = 0,8 = 80%

Step-by-step explanation:

pls make me a brinist

Other Questions
Besides organic pollutants, dead zones are also affected by nitrogen compounds. Denitrifying bacteria in the anoxic dead zones can use nitrates and nitrites as electron acceptors, thereby generating nitrous oxide, a potent greenhouse gas. What is the term used for this process?a. assimilatory nitrogen reductionb. dissimilatory nitrogen reductionc. nitrificationd. nitrogen fixation Which sequence could be partially defined by the recursive f (n + 1) = f(n) + 2.5 for n > 1? Use the Distributive Property to simplify the expression. 10(4-w)=HELP PLZ!!!!!! will give brainliest!hA class conducts a survey about types of movies. 53 girls and 48 boys reported comedy as their favorite. 23 girls and 62 boys reported horror as their favorite. Find the probability of a boy from this school selecting horror as his favorite type of movie Help me what is the slope of the line how the different occupation help our society? Makayla and Ember went shopping for OD gear and spent $262.00. If the tax rate is 5%, what is Makayla and Embers total after tax?$267.00$1,310.00$275.10$13.10 3. What are some of the differences between the Roman Republic and thegovernment of the United States? Write the ratio 7 : 4 in the form n : 1 pleaseee help me will mark brainliest Which is an example of a high-risk behavior that increases the likelihood of contracting an STI?a)using a public restroomb)having multiple sexual partners c)sharing a glass of waterd)holding hands with a partner reasons why would people be against voluntary assisted dying Suppose y varies directly as x. If y = 30 when x = 8, find y when x = 4. 1 + 1 I'm confusedddddddddddddddddddddddddddddddddddddddddd 3 + 2y = 143 - 2y = 10 Please help me w the equation and please dont take advantage of the points. Help I'm confused!This is the beginning sequence of the first exon in the mRNA sequence:AUGAAGCUCUUUUGGUUGCUUUUCACCAUUGive the DNA/genomic sequence it was transcribed from. is this correct? answer plz!! Use the Distributive Property to Factor the Expression6b+ 6 which one do you like more THUMB TACKS, PUSH PIN TACKS OR OTHER TACKS or no tacksdont forget to add the name of the tack if you say other