PLEASE NEED THIS ASAP
Write a context statement that you could incorporate into your essay. What historical context should be included when explaining the extent to which the expansion of the Mongol Empire changed culture in Afro-Eurasia? (5 points)

Explain THREE arguments that you could make to support the thesis. Then, explain which
document(s) you could use to support the thesis, and explain how your chosen documents support it.
Use at least THREE different documents in your response. (15 points)
Argument
Is Supported By
(Write the document
number.)
How?
(Explain how the point of view,
purpose, historical situation, or
audience is relevant.)

Answers

Answer 1

Contextualization

Mongol's military invasion led the empire to spread extensively. They are recognised as nomadic horsemen from the eastern steppe of Asia. The Mongols presence in Afro-Eurasia led to the decline of established early empires.

Argument 1

The Mongols affected the Russian culture by incorporating Asian characteristics into their culture.

Document 6

We can see this in the historical situation where the Mongols defended the Russians against the Europeans strengthening their bond.

Argument 2

The Mongols helped develop places for education like universities and colleges.

Document 2

Sorqotani Beki, the wife of Ulugh-Noyan’s death gave 1000 silver balish for a college to be built in Bokhara.

Argument 3

The men of Tauris attracted many merchants due to their incredible handiworks making the region flourish.

Document 1

This attracted many merchants from India and the western countries spreading their culture and beauty.

I don't know if this is right or not, but this is what I wrote.

Answer 2

There are the three argument on the basis of the different response to the related as the Mongol Empire to the changed the culture.

Argument 1. Russian culture as the effect.

Argument 1. Mongols helps to develop the education sector.

Argument 3. Mechanizing.

What is empire?

The term “Empire” refers to the region's lands and populations, as well as the regional governmental entity. The government had complete control over the empire. The imperial power is in the hands of the king and queen. There are various kinds of empires, including the Persian, British, and Mongol empires.

The Mongol military invasion caused the dominion to spread widely. They are known as nomadic warriors from Asia's eastern steppe. The arrival of the Mongols in Eurasia caused the decline of the early empires.

Argument 1: The Mongols influenced Russian culture by adopting Asian elements into their society.

Argument 2: The Mongols contributed to the development of educational institutions like as universities and colleges.

Argument 3 The men of Aries drew many merchants because of their outstanding craftsmanship, which helped the region thrive.

Learn more about Empire, here:

https://brainly.com/question/977538

#SPJ2


Related Questions

What are some things that Hitler (with the Nazis) did to gain popularity in Germany?

Answers

Answer:

the holocaust

Explanation:

Former slaves who were released from slavery were called:
O A. Indentured servants
O B. Mulattos
O C. Freedmen
O D. Chattel slaves​

Answers

Answer:

Freedmen

Explanation:

Former slaves who were released from slavery were called freedmen, signifying their emancipation and status as free individuals. Therefore, option C is correct.

Freedmen refers to former slaves who were released from slavery and granted their freedom. This term specifically highlights their transition from bondage to freedom and recognizes their status as individuals who were previously enslaved but were now legally recognized as free individuals.

During the Reconstruction era, the term "Freedmen" was widely used to refer to African Americans who had been emancipated and were navigating the challenges of establishing new lives and asserting their rights as free citizens.

Learn more about Former slaves here:

https://brainly.com/question/20378958

#SPJ7

Slavery played the BIGGEST role in which Colonial event?
A.Nat Turner's Rebellion
B.French and Indian War
C.The Stono Rebellion
D.The Civil War

Answers

Answer:

D

Explanation:

The cival war because there was no slavery in A,B or C at least not the one your talking about

Among all the given options, slavery played the biggest role in the Stono Rebellion. This was a slave rebellion in South Carolina. Thus, option 'C' is correct.

What was the Stono Rebellion?

South Carolina experienced the Stono Rebellion when it was still a province of the Kingdom of Great Britain. Many slaves who had been lured by the prospect of relocating to Spanish Florida took part in the insurrection, marching down the Stono River in the direction of Florida.

However, a South Carolina militia intercepted them and engaged the rebelling slaves in combat, putting an end to their insurrection. A literate slave led the uprising, and both white colonists and slaves were slaughtered.

The timing of the Rebellion may have been affected by a malaria outbreak in Charlestown, which created general uncertainty across Carolina.

Thus, option 'C' is correct.

Learn more about the Stono Rebellion, here:

https://brainly.com/question/514709

#SPJ5

What observations can you make about the way the framers organized the Constitution?​

Answers

Answer:

it is broken up into subsections so that readers have an easier time of finding things, and also so that it is not as long of a read.

I WILL GIVE BRAINLY!!!!

Explain whether or not he accomplished his goal
Aloha Aina
PLSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS :)

Answers

Answer:

No they didnt.

Explanation:

On September 6, 1897, the Hui Aloha ʻĀina held a hālāwai makaʻāinana - a mass meeting - at Palace Square, which thousands of poʻe aloha ʻāina - patriots - attended claiming that "We, the nation (lāhui) will never consent to the annexation of our lands, until the very last patriot lives." In the end, hawaii did get annexed meaning they did not complete their goal. I HOPE WE ARE TALKING ABOUT THE SAME GROUP BECAUSE IM NOT SURE. im talking about the hawaiin party Aloha Aina. :/ lmk , hope I could help

Clergy responded to the plague:
with confusion and a lack of answers
by blaming the Jews for it
by dying while caring for people
by shutting down trade
by praying
Select all that apply

Answers

Answer:

by dying while caring for people

by shutting down trade

by praying

Explanation:

i read the passage

In what year did Inca meet their demise to the Spanish?

A. 1492
B. 1502
C. 1522
D. 1532

Answers

Answer:D 1532

Explanation im pretty sure might be wrong tho

Answer:

D.1532

Explanation:

While there were many reasons for the fall of the Incan Empire, including foreign epidemics and advanced weaponry, the Spaniards skilled manipulation of power played a key role in this great Empire's demise.

Explain in your own words what militarism is, and how it contributed to the start of WWI.

Answers

Answer:

Britain felt that they were more powerful than all other countries. This provoked fierce competition and each country worked to build up the strongest military. This led to an arms race between these three powers.

Explanation:

what is militarism -- the belief or desire of a government or people that a country should maintain a strong military capability and be prepared to use it aggressively to defend or promote national interests

What was Dr.Seuss's opinion of American neutrality?

Answers

Answer: A permanently neutral power is a sovereign state which is bound by international treaty, or by its own declaration, to be neutral towards the belligerents of all future wars. An example of a permanently neutral power is Switzerland.  For example, it may allow its territory to be used for the war effort.

Explanation:

A permanently neutral power is a sovereign state which is bound by international treaty, or by its own declaration, to be neutral towards the belligerents of all future wars. An example of a permanently neutral power is Switzerland.

What is treaty ?

A formal, written treaty is a binding agreement between parties to international law. It is often created by and between sovereign states , however it may also involve people, businesses, and other legal bodies. Among other names, a treaty is often referred to as an international agreement, protocol, covenant, convention, pact, or exchange of letters.

However, under international law, only agreements that have legal force between the parties are regarded as treaties. Treaties differ based on duties (how closely states must adhere to the rules), accuracy (how clearly the rules must be followed), and delegation (the extent to which third parties have authority to interpret, apply and make rules).

To know more about international law

https://brainly.com/question/18597093

#SPJ2

The Framers of the Constitution chose to make the amendment process challenging to prevent careless and constant changes. Choose ALL true statements about the amendment process. A) It can be approved if the President, Vice President, and House Speaker agree. B) It must be approved by 2/3 of both the House of Representatives and Senate. C) It can be approved by a vote of 3/4 of United States citizens during an election. D) It must be approved by 3/4 of the states' legislatures at a Constitutional Convention. E) It can be approved by a vote at a Constitutional Convention called by 2/3 of all state legislatures.

Answers

The correct answers are B) It must be approved by 2/3 of both the House of Representatives and Senate. E) It can be approved by a vote at a Constitutional Convention called by 2/3 of all state legislatures.

These are true statements about the amendment process.

The Constitution cannot be amended by a decision of the Executive branch only or any other branch. And of course, it cannot be amended by the citizens of the United States in any election.

That is why, during the Constitutional Convention held at Philadelphia, Pennsylvania in the summer of 1787, the delegates debated on the new form of government, created a new constitution, and decided on the ways to amend it. The Framers of the Constitution chose to make the amendment process challenging to prevent careless and constant changes, or that could benefit one particular interest group or political faction.

Answer:

the correct answers are b, d, and e

Explanation:

trust me i just took the test

how were the chinese religion/philosophy and government related
PLEASE HELP THIS IS DUE TODAY AND IM DUMB FOR NOT DOING THIS THX

Answers

Answer:

We in academe must do more to ensure today’s students become tomorrow’s skilled thinkers. Fortunately, we are in a position to do so without having to overturn the current higher education system or break the bank, writes Jonathan Haber.

Explanation:

who are dreamers and schemers

Answers

Answer:

i dream then i scheme

Explanation:

Answer:

dreamers are people who think about their life in a good way, where they succeed.

schemers are just people who try to create a secret plan to sabotage, or break something for their own good

Explanation:

I'm not really sure on what you mean on this question, but I hope it helps ;D

how did nationalism contribute to global conflicts following world war 1

Answers

Answer: Gandhi Ji came back from South Africa and let to major awakening among the common people.

Explanation:

when did the cilvil war start and when did it end

Answers

Answer:

The war began when the Confederates bombarded Union soldiers at Fort Sumter, South Carolina on April 12, 1861. The war ended in Spring, 1865.

Explanation:

Answer:

It began on April 12 1861, and ended on May 9th, 1865.

Explanation:

The Civil War first began when Confederates bombed Union Soldiers at Fort Sumter. It ended when Robert E. Lee surrendered the last big Confederate army to Ulysses S. Grant. The last battle of the Civil War was fought at Palmito Ranch in Texas. The main cause of the Civil War were slaves. The northern colonies wanted to get rid of slaves and treat everyone with respect and equality but the southern colonies didn't want to and they wanted to keep their slaves. This led to a Civil war that lasted 4 years.

will mark brainliest!! hurry please.

Answers

Answer:

D

Explanation:

The 18th amendment caused an uproar, and did quite the opposite of making americans stop drinking.

What benefits did imperialism bring to Latin America and asian countries?

Answers

Tension of major power over imperalism

What did the Inca call the hidden place they retreated to when they heard of Francisco Pizarro

A. Cuzco
B. Paititi
C. Lima
D. Parapata

Answers

Answer:

I think its b

Explanation:

.

I think it is b as well

A - - B ¿A cual de los siguientes hombres cree que debe atribuírsele mayor mérito por su contribución al progreso de la humanidad? (A: Aristóteles, B: Simón Bolívar)

Answers

Answer:

A. Aristóteles

Explanation:

Los aportes de Aristóteles, sin lugar a duda, han sido más importantes a lo largo de la historia que los aportes de Simón Bolívar.

Aristóteles no sólo es uno de los padres de la filosofía, sino también del pensamiento científico. Por ejemplo, Aristóteles fue uno de los primeros en sistematizar un enorme conocimiento en botánica y zoología.

Su influencia ha sido enorme durante toda la historia, tanto así que en la edad media Aristóteles no sólo era considerado un filósofo más, sino que era considerado "El Filósofo", lo cual habla de su enorme legado.

What are the reasons the writer of this letter (Richard Henry Lee) is against the adoption of the
Constitution? Answer in a paragraph

Answers

Answer:

Explanation:

Richard Henry Lee in many ways personified the elite Virginia gentry. A planter and slaveholder, he was tall, handsome, and genteel in his manners. Raised in a conservative environment, Lee was nonetheless radical in his social and political views. As early as the 1750s, he denounced slavery as an evil, and he even favored the vote for women who owned property. Lee was also among the first to advocate separation from Great Britain, introducing the resolution in the Second Continental Congress that led to independence.

Though Lee was a planter, politics was his true calling. He reveled in backroom bargaining and during the imperial crisis he learned how to utilize mob action to resist British tyranny. In denouncing British transgressions, Lee’s oratory was said to rival that of his more renowned fellow Virginian, Patrick Henry. Lee was an ally and friend of Samuel Adams, who shared the Virginian’s aversion to money-grubbing and ostentatious displays of wealth. Like Adams, Lee neglected his financial affairs and often struggled to make ends meet. At one point in his life, he was forced to live on a diet of wild pigeons.

The Andes in western South America are an example of a landform that arises from the ___.

Answers

Answer:

Subduction of an oceanic plate by a continental plate.

Explanation:

The South American plate and the Nazca plate collided over a long time causing the uplift of the mountains.  

What was the belief that the United States should reach from the Atlantic
Ocean to the Pacific Ocean?
O A. TWO-Ocean Nation
B. America's Future
O C. American Destiny
O D. Manifest Destiny

Answers

Answer:

D. Manifest Destiny

Explanation:

Manifest Destiny, a phrase coined in 1845, is the idea that the United States is destined—by God, its advocates believed—to expand its dominion and spread democracy and capitalism across the entire North American continent.

I hope thia was helpfull


Which of the following terms of the Law of April 6, 1830, would NOT have upset the Anglo settlers?
A Trade between Mexican and Texas ports was to expand.
B.O New empresario grants were to be cancelled.
C.Immigration from the U.S. into Mexico was prohibited and no slaves could enter into Texas or Mexico.
D. Border taxes were to be collected.
DOLL

Answers

Answer:

c

Explanation: did it on edge

What culture did the Egyptians and Nubians share

Answers

Answer:

What are some characteristics shared by ancient Egypt and Nubia? the Nubians worshipped Egyptian gods and goddesses along with their own Nubian deities. The Nubians also adapted Egyptian hieroglyphs to fit their own language and created an alphabet

Explanation:

our task is to create a newspaper advertisement encouraging people to move west back in the early to mid-1800s. Make sure to include the following information:

why people should go -- the lesson gives a few reasons
where they should go -- which state?
how to get there -- which trail(s)?
what to bring -- the lesson give a lot of specific items
what life will be like -- specific details
who they may meet -- discuss the different cultures already in the west
possible dangers -- list at least 3

Answers

Answer:

what writing form do i put it in

Explanation:

?

how did the mycenaeans gain wealth and power

Answers

Answer:

The Mycenaeans expanded their society through trade and military conquest.

Explanation:

I got it from edge :)

How does the president limit the judicial powers of the courts?

Answers

Answer:

He can grant reprieves and pardons

Explanation:

Answer:

A. He can grant reprieves and pardons

Explanation:

What is the significance of the trade route to India from the West founded by Vasco de Gama?

Answers

His discovery of this sea route helped the Portuguese establish a long-lasting colonial empire in Asia and Africa.

that was one of the most important effects of the war in 1812
a.the Federalist Party took control of the u.s. politics
b.the United States took over the Louisiana Territory
c.the United States gain more worldwide influence
d.slavery was banned in most of the United States
need help ASAP

Answers

Answer:

c

Explanation:

What is terrace farming and why did the Incas need to use it?

Answers

Answer:

The terraces were built to make the most efficient use of shallow soil and to enable irrigation of crops by allowing runoff to occur through the outlet. The Inca built on these, developing a system of canals, aqueducts, and Iquitos to direct water through dry land and increase fertility levels and growth.

Explanation:

Terrace farming is a technique used to grow crops on steep slopes by building a series of leveled terraces into the hillside. This method of farming helps to prevent soil erosion, conserve water, and maximize arable land in areas with limited flat land.

What is terrace farming ?

The Incas, who lived in the Andes Mountains of South America, needed to use terrace farming due to the rugged terrain of their homeland. They constructed thousands of terraces, using stone walls to create level platforms that could support crops such as potatoes, maize, and quinoa. By using terrace farming, the Incas were able to cultivate crops at high altitudes and produce enough food to sustain their large population.

Terrace farming also allowed the Incas to adapt to the harsh climate and unpredictable weather conditions in the Andes, where they experienced frequent droughts and frost. By using terraces, they were able to irrigate their crops and protect them from frost damage.

Overall, terrace farming was a critical technique for the Incas to survive and thrive in their mountainous homeland.

Learn more about terrace farming here

https://brainly.com/question/30231258

#SPJ3

Which of the following Western countries was NOT involved in the partition of Africa after 1880? A Belgium B Germany C Italy D the Netherlands

Answers

Answer:i think it is c

Explanation:

Other Questions
Use the Distributive Property to simplify the expression. 10(4-w)=HELP PLZ!!!!!! will give brainliest!hA class conducts a survey about types of movies. 53 girls and 48 boys reported comedy as their favorite. 23 girls and 62 boys reported horror as their favorite. Find the probability of a boy from this school selecting horror as his favorite type of movie Help me what is the slope of the line how the different occupation help our society? Makayla and Ember went shopping for OD gear and spent $262.00. If the tax rate is 5%, what is Makayla and Embers total after tax?$267.00$1,310.00$275.10$13.10 3. What are some of the differences between the Roman Republic and thegovernment of the United States? Write the ratio 7 : 4 in the form n : 1 pleaseee help me will mark brainliest Which is an example of a high-risk behavior that increases the likelihood of contracting an STI?a)using a public restroomb)having multiple sexual partners c)sharing a glass of waterd)holding hands with a partner reasons why would people be against voluntary assisted dying Suppose y varies directly as x. If y = 30 when x = 8, find y when x = 4. 1 + 1 I'm confusedddddddddddddddddddddddddddddddddddddddddd 3 + 2y = 143 - 2y = 10 Please help me w the equation and please dont take advantage of the points. Help I'm confused!This is the beginning sequence of the first exon in the mRNA sequence:AUGAAGCUCUUUUGGUUGCUUUUCACCAUUGive the DNA/genomic sequence it was transcribed from. is this correct? answer plz!! Use the Distributive Property to Factor the Expression6b+ 6 which one do you like more THUMB TACKS, PUSH PIN TACKS OR OTHER TACKS or no tacksdont forget to add the name of the tack if you say other if g(x)=2(x-4), find the value of x if g(x)=201) 322) 123) 144) 10please HELP How does Baines depict the working environment in the cotton mill ? Is it safe or dangerous?