Medicine High School

The main idea behind Maslow’s hierarchy of needs is that
the most important needs must be met before the less important human needs can be met.
all needs are equally important and must be met simultaneously to achieve full health and success.
there are a few less important needs that must be met before the many important needs can be met.
all needs are equally important and their ability to be met can vary in timing.

Answers

Answer 1
first one fits best!
Answer 2

Answer:

It is A!!!!

Explanation:

Related Questions

What is the healthy percentage of body fat for men?

Answers

Answer:

The answer would be 18-24%.

Explanation:

The amount of essential fat differs between men and women, and is typically around 2-5% in men, and 10-13% in women. The healthy range of body fat for men is typically defined as 8-19%, while the healthy range for women is 21-33%.

16. The use of an electronic signature needs to be in compliance with
ОНІРАА.
O AMA.
Ostate laws.
O HEDIS.

Answers

Maybe state laws since your signature is on your identification? Not sure.

How do blood types react in a transfusión ?

Answers

Answer:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Explanation:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Which structure is correctly described as exhibiting bilateral symmetry
O fingers that are distal to the arm
O an eye on each side of the sagittal plane
O a bely button along the medial area of the body
O the head in the upper portion of the transverse plane

Answers

An eye on each side of the sagittal plate
2./ B. an eye on each side of the sagittarius plane

Which represents the order of increasing educational levels?
professional –assistant-technologist-technician
technologist –assistant-professional-technician
technician –professional-technologist-assistant
assistant –technician-technologist-professional

Answers

the fourth one is correct
The answer is D!!!!!!!!

Complete the sentence to describe a procedure for food animals. Bulls are to improve the quality of beef, and to make the animals easier to manage.

Answers

Answer:

Castrated

Explanation:

Castration of bulls: Bulls or male calves are castrated to improve the quality of beef. This procedure also makes the animals less aggressive towards the rest of the herd.

Size-wise, your heart occupies about_____ of the space in your upper chest.

A. 1/10th
B. 1/4th
C. 1/2
D. 1.20th

Answers

Answer:b

Explanation:

Size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

What is heart?

Heart is defined as an organ that pumps blood throughout your body and is around the size of your fist. It is composed of numerous tissue layers. The core of your circulatory system is your heart. The heart is an important organ. It is a muscle that helps your body's blood flow throughout. The blood that your heart pumps provides your body with the oxygen and nutrition it needs to function.

The human heart is located in the mediastinum, which is a portion of the thoracic cavity located medially between the lungs. Low oxygen blood is taken from the body and pushed through the right atrium to the right ventricle. The blood with less oxygen is sent to the lungs via the right ventricle. Blood that is rich in oxygen is drawn from the lungs and pumped to the left ventricle by the left atrium.

Thus, size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

To learn more about heart, refer to the link below:

https://brainly.com/question/16566688

#SPJ2

why are technical schools established?​

Answers

It established vocational education as acceptable training for certain future professionals who wouldn't need bachelor's degrees to do their jobs, such as plumbers, mechanics, and factory workers. They completed their training in focused vocational programs associated with high schools.

MEDICAL TERMINOLOGY!!

Answers

Medical terminology is language used to precisely describe the human body including its components, processes, conditions affecting it, and procedures performed upon it. Medical terminology is used in the field of medicine.

Use the drop-down menus to select the best
answers.
Some myocardial infarctions involve erratic heart
behavior, such as

1.creating more carbon dioxide.
2.missing beats.
3.producing more oxygen.
4.pumping more blood.

PLEASE HURRY

Answers

number two! good luck!

Answer:

Explanation:

the second part is cardiac arrest

Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :


PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)

Answers

Answer:

i put an answer but someone deleted it

Explanation:

Project: Strategies for Effective Communication
In the lesson, there is a chart of strategies for effective communication. You will use this chart to complete your assignment. Select eight of the strategies. For four of the strategies, describe a situation where a team member models effective communication. For the other four strategies, describe a situation where a team member exhibits a breakdown in communication. Each scenario must be at least one paragraph in length.

For example: If the strategy was to always greet a patient in a positive and friendly way, we could describe a situation where a health care worker modeled this behavior or a situation where a health care worker did not act appropriately.

After you complete your scenarios, do some research online or in the library. Find at least two more strategies for effective communication. Provide an example of ineffective communication and effective communication related to each strategy. Discuss why you selected each strategy and how you think each strategy can be useful in effective communication. Make sure that you select strategies that were not mentioned in the chart or used as an example in the lesson.

Answers

Answer:

Focus on the issue, not the person. ...

Be genuine rather than manipulative. ...

Empathize rather than remain detached. ...

Be flexible towards others. ...

Value yourself and your own experiences. ...

Use affirming responses.

Meet regularly. Hold regular strategy meetings for the entire team. ...

Be inclusive. ...

Be transparent, clear and concise. ...

Show some respect. ...

Recognize that being right may be wrong. ...

Use online collaboration tools.

Explanation:

''.''

how do I make a homemade bandaid ​

Answers

Answer:

Put a paper Towel down and tape it

Explanation:

Don’t be a real man, that is my answer

HELP PLEASE
Which would bring out the details in a tire track in mud?
A)casting an impression with dental stone
B)burning magnesium ribbon
C)casting an impression with putty
D)photography with direct lighting

Answers

i believe the answer is D. it seems like the most reasonable one

The correct option is D) photography with direct lighting because it clearly shows the path and details of the tiretrack.

Tire marks can be seen on snow, mud, soil, sand, and even victims of crime scenes. These traces can be collected by photographing, pouring, lifting, and collecting the victim's clothing.

What is evidence of the pattern?

Tire marks are classified as evidence of the pattern, as tire marks leave a unique pattern. Just as shoe marks help narrow down brands, styles and sizes so can tire trucks.

Thus it clearly concludes that photography with direct lighting can collect great evidence.

To know more about tire track evidence refer to the link :

https://brainly.com/question/13397634

Solve: -3x+1<-5
X>
X> 2
4
x<-2

Answers

The answer is X>2 :))

What is the function of the serous membrane? (Be specific about what types of body cavities)

Answers

To transfer semen from the uterus to the finger nails

Answer:

Serous membranes line and enclose several body cavities, known as serous cavities, where they secrete a lubricating fluid which reduces friction from muscle movement. Serosa is entirely different from the adventitia, a connective tissue layer which binds together structures rather than reducing friction between them.

Explanation:

BRAINLIEST PLZZZZZZ

Other Questions
Which type of growth occurs when population growth slows or stops after a period of exponential growth?decreasingexponentiallinearlogistic PLEASE HELP .!!! ILL GIVE BRAINLIEST.. *EXRTA POINTS* .. DONT SKIP :(( ! ILL GIVE 40 POINTS . Que pasara si llegars a tu casa y encontrars a otra familia diferente ala tuya viviendo ah? A consumer agency wants to determine which of two laundry detergents, A or B, cleans better. Fifty pieces of fabric are subjected to the same kinds of stains (grass, mud, coffee). Then 25 pieces are randomly assigned to be cleaned with detergent A, and the remaining 25 pieces are cleaned with detergent B. After being laundered, the pieces of fabric are rated on a scale of 110, with 1 being the least clean to 10 being the most clean. The mean rating for detergent A is found to be significantly less than the mean rating for detergent B. Which statement best summarizes the theme hans in luck The answer is not 53.4. Please help. 15x+98=105 What is the value of x and please show your work. :) Lane bought 12 pencils for$0.39 each. What was the total cost of thepencils before sales tax was added? Given the linear inequality graph, which statements are true?A)Point (8,3) is a solution.B)The graph represents y- 1 x + 5.9The graph represents y s 3x + 5.DAll points in the blue area are solutions.E)All points above the broken line are solutions, In 1519, the first Native Americans introduced to Hernando Corts of Spain were the _____.A.) AztecsB.) IncasC.) HohokamD.) Mayas On the European front the most important development of the past year has been without question the crushing counteroffensive on the part of the great armies of Russia against the powerful German army. What is the most likely intended effect of the language crushing counteroffensive and powerful in this text? To encourage Americans to believe they were making real progress. To encourage young men and women to enlist in the cause. To prevent Americans from viewing the Russian army as a threat. To suggest America should invest more in its military defense 14.4x - 28.2 > 36.6What is the solution to the inequality? Enter the answer in the box.X> Whats is this?? the discount price of a hat is $24. whats the regular price Find the values of x and y in the equation below.aby08y =DONEM P + N = 8, where P = pennies and N = nickels. If the value of the coins is 28 cents, what other equation is necessary to find the number of each coin?Select one:a.P + 5N = 28b.5P + N = 28c.P + 28 = 5Nd.(1 + 5)N = Pe.8 + N = 28 if any body does Lincoln Douglas debate, please let me know because I could use some help with how wording on part of my case. #3: A home security company provides security systems for $5 per week plus an installation fee. The total fee for 12 weeks of service is $210. Write and solve a linear equation to find the cost of the installation fee. Tony can type at a constant rate of 110 words every 2 minutes.Write an equation for the number of words, W, Tony can type in T minutes. Describe the brightness and temperature of the stars classified as giants. What can accurately predict whether you will be a successful entrepreneur?