There is water inside your water bottle. Identify the solid. ​

Answers

Answer 1

Answer:

the water bottle

Explanation:

sorry if its wrong


Related Questions

Nitrogen from animal wastes or plant an animal tissue
O must be fixed near leguminous plants,
O is lost from the system.
O is fixed by bacteria and fungi in the soil.
O is already fixed and can be used.

Answers

System is okay better

Nitrogen from animal wastes or plant an animal tissue  is fixed by bacteria and fungi in the soil.

So, option C is correct one.

How plants and animals get nitrogen ?Since our atmosphere contains 78% of nitrogen but it is very difficult  to take directly by plants and animals.Nitrogen is very essential for all living organism.Plants take nitrogen from soil.Some bacteria and fungi are present in the soil who fix nitrogen from the atmosphere and convert it into nitrogen compound.Then this nitrogen from the soil by root system of the plants.Now plant use this nitrogen for synthesis of proteins and other compounds.Animals who feed plants gets this proteins and other nitrogen compound from plants.When plants and animals die , fungi and bacteria present in the soil converts this nitrogenous waste into nitrogenous compound and reuse of nitrogenous compound is repeated again.

learn about nitrogenous waste,

https://brainly.com/question/9423629

#SPJ2

Which is true?
A.Ocean currents affect temperatures on land.
B. The ocean has no effect on the temperature on the land.
C. Ocean water does not move between locations.
D. All ocean water is the same temperature.

Answers

Answer:

I think it's A.

Explanation:

Sorry If I'm wrong

the correct answer is A, hope this helps :))

Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.

Answers

Answer:

genes are segments of chromosomes that form tight coils called dna

The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:

Genes are segments of chromosomes that form tight coils called DNA.

Thus, the correct option is D.

What is Chromosome?

A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.

Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.

Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.

All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.

Therefore, the correct option for this question is D.

To learn more about Chromosomes, refer to the link:

https://brainly.com/question/11912112

#SPJ6

7th Grade Science Yes i will brain list
What is a convection current?

Answers

a current in a fluid that results from convection.

Nerve cells that can detect chemicals are:
A. chemoreceptors.
B. chemtransductors.
C. limbic system indicators.
D. neurotics.

Answers

Answer:

its Chemoreceptors

Explanation:

A chemoreceptor, also known as chemosensor, is a specialized sensory receptor cell which transduces a chemical substance to generate a biological signal.

What is one way during the G0 phase that a mistake during the cell cycle could result in problens for the G0 phase?​

Answers

The G0 phase (G sub zero) or the zero of G is a period of the cell in which it remains in a vegetative state. The G0 phase is seen as a distinct and quiet stage that occurs outside the cell cycle. This phase is related to the "Post-Mitotic" state because they are in a non-dividing phase outside of the cell cycle; some cell types (such as neurons and heart muscle cells) when they reach maturity (that is, when they are terminally differentiated) become post-mitotic (enter the G0 phase), and perform their main functions for the rest of the life of the organism. Poly-nucleated muscle cells that do not undergo cytokinesis are often considered G0 phase cells.

The G0 phase (G sub zero) or the zero of G is a period of the cell in which it remains in a vegetative state.This phase is related to the "Post-Mitotic" state because they are in a non-dividing phase outside of the cell cycle.

Which muscle cells are often considered as G0 phase cells?

Poly-nucleated muscle cells that do not undergo cytokinesis are often considered G0 phase cells.The G0 phase is seen as a distinct and quiet stage that occurs outside the cell cycle.

Mitosis is the procedure with the aid of which a mobile replicates its chromosomes after which segregates them, producing two identical nuclei in training for mobile division. Mitosis is generally followed by way of same department of the mobile's content material into  daughter cells that have identical genomes.

The two phases of cell cycle are interphase in which DNA replication occurs, 3 stages of interphase are: G1 phase, S phase and G2 phase and mitotic in which division occurs phase. Mitosis occurs after the completion of DNA replication and doubling of chromosome number and cell contents and after mitosis, two daughter cells are produced of equal number of chromosomes.

Therefore, The G0 phase (G sub zero) or the zero of G is a period of the cell in which it remains in a vegetative state.This phase is related to the "Post-Mitotic" state because they are in a non-dividing phase outside of the cell cycle.

Learn more about mitosis on:

https://brainly.com/question/29776367

#SPJ5

What does order mean in biology

Answers

Answer:

A taxonomic rank used to classify organisms that is typically lower than the class and consists of families with comparable natures or characteristics.

OAmalOHopeO

Select the correct blsector of the segment.
M
А
B
M
2
M
D
M

Answers

Answer:

B

Explanation:

because it has a slant p and q bisector

What is the earth?
What is the atomosphere

Answers

Answer:

Earth's atmosphere is a layer of gases surrounding the planet Earth and retained by the Earth's gravity.

Explanation:

It contains roughly 78% nitrogen and 21% oxygen 0.97% argon and carbon dioxide 0.04% trace amounts of other gases, and water vapor. This mixture of gases is commonly known as air.

Answer:

Earth is the third planet from the Sun and the only astronomical object known to harbor life. About 29.2% of Earth's surface is land consisting of continents and islands.Earth's atmosphere is a layer of gases surrounding the planet Earth and retained by the Earth's gravity. It contains roughly 78% nitrogen and 21% oxygen 0.97% argon and carbon dioxide 0.04% trace amounts of other gases, and water vapor. This mixture of gases is commonly known as air.

Explanation:I cited this as my claim because it shows and explains the question that is giving.

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

which is more specific chordata or Eukarya​

Answers

Chordata

:):):):):):)

Bacteria reproduce in a process called binary fission which of the following is true about binary fission?

Answers

The answer is D :) the offspring will have identical DNA from their parents

what direction was the texas annexation in?

Answers

They faced washington DC

In the seventeenth century, Francesco Redi performed experiments using raw meat placed in jars.
• Half of the jars were covered, and half were left open,
• Redi noticed that the meat in the sealed jars did not have maggots, but the meat in the open jars did have maggots.
Redi concluded that only flies could make more flies,
.
Which part of the cell theory corresponds to Redi's findings?

Answers

Answer: B

Explanation:

''New cells come from the existing cells'' is a part of the cell theory which corresponds to Redi's findings.

Experiment performed by Francesco Redi

Francesco Redi conducted an experiment in which he showed that living organisms come from other living organisms. This worked combine with the work of other later scientists, helped to develop the third part of the cell theory which is cells come from other living cells.

Learn more about cell theory here: https://brainly.com/question/3966602

What is the definition of a DNA Polymerase

A. Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
B. An enzyme that unwinds the DNA double helix during DNA replication
C. A class of nucleotides that includes adenine and guanine.
D. A bond between complimentary base pairs in DNA​

Answers

A. I hope this hopes

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Anything that has mass and takes up space is called __________. *
pressure
viscosity
matter

Answers

Answer:

A

Explanation:

Answer:

matter

Explanation:

jshegdvdjjdbdhrhrvhr

Can u pls help me this is due today I will give brainliest

Answers

Answer:

exmaple z

Explanation:

it is the heaviest so it would require more to push

this is physics not bio btw

work= force x distance

answer: 8kg

explanation: weight is a force, and the distance is equal in all examples...so the heaviest object is going to need the most work to pull through the distance

(Many points) PLS HELP QUICK dont guess answer pls ad dont say random answers for points pls

Cheng made a chart to list the functions of certain fish structures.

(The image below)

Which headings correctly complete the chart?

X: Fin
Y: Swim bladder
Z: Lateral line
X: Fin
Y: Lateral line
Z: Swim bladder
X: Lateral line
Y: Swim bladder
Z: Fin
X: Lateral Line
Y: Fin
Z: Swim bladder

Answers

Answer:

x:fin

y:lateral line

z:swim bladder

Answer: The answer for this question is Fin for x  Lateral line for y and

swim bladder for z

Explanation:

I took the test

the receptionist said to the manager,'I have booked your flight tickects for Monday'. change into imdirect speech​

Answers

Answer:

The correct answer is-  The receptionist told the manager that he had booked his flight tickets for Monday

Explanation:

Indirect speech is the expression any statement of a consverstaion that occured in past without quoting explicitly. Indirect speech is the stating any quoted statement in simple statement. In this type of speech some grammer and certain noun and pronoun change accordingly.

So the correct indirect speech of the receptionist said to the manager,'I have booked your flight tickects for Monday'. would be The receptionist told the manager that he had booked his flight tickets for Monday

What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?

Answers

Answer:

Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.

Hope this helped!

Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?

Answers

Answer: The basic answer could be because of the tectonics plates.

Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.

Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.

Why are rocks folded?

Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.

Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.

Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.

Learn more about rocks, here:

https://brainly.com/question/29561452

#SPJ2

Do humans and plants get their nutrients the same way?

Answers

Answer:

As humans require a lot of nutritious food for the growth, same way plants also require nutrients in order to grow. Plants which are grown in the soil gets all the required nutrients from the fertilizers and from the land where natural nutrients are stored.

plants use photosynthesis

which statement describes what happens with ATP during glycolysis?

A) more ATP is produced than is used

B) glycolysis splits ATP

C) more ATP is used than is produced

D) glycolysis does not make any ATP

Answers

Answer:

A. more ATP is produced than used

Explanation:

Regulation of glycolysis

Several steps in glycolysis are regulated, but the most important control point is the third step of the pathway, which is catalyzed by an enzyme called phosphofructokinase (PFK). This reaction is the first committed step, making PFK a central target for regulation of the glycolysis pathway as a whole^1  

1

start superscript, 1, end superscript.

PFK is regulated by ATP, an ADP derivative called AMP, and citrate, as well as some other molecules we won't discuss here.

ATP. ATP is a negative regulator of PFK, which makes sense: if there is already plenty of ATP in the cell, glycolysis does not need to make more.

AMP. Adenosine monophosphate (AMP) is a positive regulator of PFK. When a cell is very low on ATP, it will start squeezing more ATP out of ADP molecules by converting them to ATP and AMP (ADP + ADP \rightarrow→right arrow ATP + AMP). High levels of AMP mean that the cell is starved for energy, and that glycolysis must run quickly to replenish ATP^2  

2  squared.

1. Energy transfer is inefficient between trophic levels because

A. Molecules are fully digested from each trophic level.

B. Dead organisms and waste are recycled throughout the trophic levels.

C. Organisms within a trophic level are fully consumed.

D. All organisms within a trophic level die.

2. Primary productivity is defined as

A. The rate that plants and other photosynthesis organisms produce organic compounds.

B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.

C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.

D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.

Thanks if you help, It's highly appreciated. :-)​

Answers

Answer: b dead organisms And waste are recycled throughout the tropic levels.

Explanation:

Answer:

part 2

the rate that plants and other photosynthetic organisms produce organic compounds.

Explanation:

:)

Interphase
21. Before Meiosis, comes
cell activities, like making
During interphase, the ce
for example.
22. Uncoiled stringy DNA is called​

Answers

uncoiled stringy dna is called chromatin

what is the function of mitrochondria

Answers

Answer: Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).

Explanation:

Answer: The mitochondrionis a double membrane-bound organelle found in most eukaryotic organisms. Some cells in some multicellular organisms lack mitochondria (for example, mature mammalian red blood cells). A number of unicellular organisms, such as microsporidia, parabasalids, and diplomonads, have reduced or transformed their mitochondria into other structures.

Explanation:

Any one free
InboX me (◍•ᴗ•◍)❤​

Answers

Answer:

hiii

Explanation:

Do all plants respond the same to all abiotic factors?

Answers

Answer:

Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.

Why does DNA need to make a transcript of itself and what is this transcript called?

Answers

Answer:

DNA needs to be transcribed itself as a mechanism for the multiplication of its molecules, and this transcription process is called DNA replication.

Explanation:

DNA replication is a mechanism that allows it, from one molecule, to obtain two molecules identical to the original. In other words, it transcribes the information from one of its strands to a new strand.

The process of DNA replication is semi-conservative, because each new molecule is formed by an original strand and a new strand, which contributes to maintaining the integrity of the genetic information.

As a requirement of the cell division process, as mitosis,  DNA must replicate so that each daughter cell has the same genetic information as the original cell. This is why replication of this nucleic acid occurs.

Other Questions
Styling is how something is said or made.TrueFalse (WILL GIVE BRAINLIEST IF YOU SHOW THE WORK!) The Jones family just ate at a new restaurant and the bill came to $52.75. They want to leave a 15% tip for the waiter. How much is the tip? What is the total amount that they spent including the tip? Find the difference. DWhich of the statements describe the transformation onthe left? Check all that apply.NOPQR-N'O'P'Q'R'ONOPQR- NOPQRO QRNOP R'N'O'P'Q'NOPQR maps to N'O'P'Q'R'O QPONR maps to Q'P'O'N'R'NRNR Round the following numbers to the tenths place.1. 1295.9549 Which of the items below signify that someone might be experiencing dating violence? 1-Avoids spending time with friends 2-Changes political views 3-Seems uncharacteristically relaxed 4-None of these are warning signs How did the admission of territories acquired by the U.S. in the Mexican War shed light on the root issues dividing north and south for decades before the Civil War write in brief about Giuseppe Mazzini ? 2 minutes speech about money Which word does Not describe how Gothic architecture was originally considered A. Crude B. Uncivilized C. Refined D. Rough Which of these is a financial service offered to business owners?A.) Core CompetenciesB.) Dividend paymentsC.) InsuranceD.) Operational efficiencies help with this bounds question please 6.A circle has a diameter of 11 inches. What is the circumference of the circle using 3.14? = . Single choice. what is "hi how is your day going" in Spanish Recall that if the colliding objects have hard surfaces, the collision is elastic. Based on this description, which bumper design is more likely to result in an elastic collision? Predict how this bumper design will change the force that car 2 experiences during the collision. What are the different parts of a map? What does each part of the map tell you? Which of the following is not the feature of accounting?Select one:a. Summarizingb. CollectingC. Recordingd. Classifying Which statement best describes the narrative point ofview in this passage?It is impossible to say how first the idea entered mybrain; but once conceived, it haunted me day and night.Object there was none. Passion there was none. I lovedthe old man. He had never wronged mne. He had nevergiven me insult. For his gold I had no desire. I think itwas his eyel yes, it was this! He had the eye of a vulturea pale blue eye, with a film over it. Whenever it fell uponme, my blood ran cold; and so by degrees-very gradually-I made up my mind to take the life of the old man, andthus rid myself of the eye forever.The passage uses a third-person point of view anda reliable, all-knowing narrator.reliable, all-knowing narrato.an unreliable narrator.OThe passage uses a first-person point of view and aOThe passage uses a third-person point of view and-"The Tell-Tale Heart,"Edgar Allan PoeThe passage uses a first-person point of view andan unreliable narrator. I need help ASAP please answer the pic below