Wave erosion cause a central coast line to recede at a rate of 3cm each year this occurs uninterrupted for a period of 8 years 

Answers

Answer 1

According to the given statement The coastline has receded 24 centimeters after 8 years.

What is an erosion?

Earthen materials are worn away during erosion, a geological process in which they are moved by wind or water. Weathering, a related process that does not involve movement, dissolves or breaks down rock.

Briefing:

The coastline is said to regress by 3 centimeters annually.

The entire distance that the shoreline recedes is 8 times greater than it is in a year if this continues uninterrupted for 8 years. This is:

D = 8*3cm = 24cm

The coastline has receded 24 centimeters after 8 years.

To know more about Erosion visit:

https://brainly.com/question/3852201

#SPJ10


Related Questions

The process of mitosis is sometimes compared to the asexual reproduction of simple organisms because of the similarities that they share. Which of the following is a similarity that mitosis and asexual reproduction share?

Answers

Answer:

cell divide to form a new species

Both mitosis and asexual reproduction both divide cells to form a new species.

What do you mean by mitosis and asexual reproduction?

Asexual reproduction is a type of reproduction that does not involve the fusion of gametes or change in the number of chromosomes.

Mitosis is a part of the cell cycle in which replicated chromosomes are separated into two new nuclei. Cell division by mitosis gives rise to genetically identical cells in which the total number of chromosomes is maintained.

Therefore, some organisms can use mitosis to reproduce asexually. The offspring of asexual reproduction are genetically identical to each other and to their parent. Most single-celled, microorganisms reproduce asexually by duplicating their genetic material and dividing in half.

Learn more about mitosis and asexual reproduction:

https://brainly.com/question/1632

#SPJ2

need help for the other 3 questions, thank you!

Answers

1. The other complementary strand of this DNA strand will be:

TAATTTGCTAGGTAGCGTCCA

2. TAA TTT GCT AGG TAG CGT CCA

The amino acid sequence of this strand will be: Stop codon, Phenylalanine, Alanine, Arginine, Stop codon, Arginine, Proline.

3. There are 7 codons in this gene.

4. There are 7 amino acids in this protein.

What are amino acids?Special chemical compounds known as amino acids are used by living things to build proteins. Nitrogen, oxygen, hydrogen, and carbon make up the majority of the elements in amino acids. Twenty distinct types of amino acids are used in the creation of proteins in our body. Some amino acids are actually made by our bodies, while the rest must come from diet.Transcription is the first stage of protein synthesis. At this point, the cell copies (or "transcribes") the DNA. Because it makes use of ribonucleic acid, a different kind of nucleic acid, the copy of DNA is known as RNA. The next procedure is known as translation, and it makes use of RNA.Translation is the following stage in the production of a protein. This is the process by which the RNA is changed (or "translated") into a series of amino acids that constitutes the protein.A complicated mechanism in the cell called the ribosome performs the translation process, which creates the new protein from the RNA instructions.

To learn more about Amino acids, refer to:

https://brainly.com/question/14583479

#SPJ13

Are vesicles found in plant cells, animal cells, or both?

Answers

both of them have it

Answer:

both

in plants cells, there is one large while in animal cells there are many in small sizes

Please mark as brainliest

10 One reason a fish that lives in the ocean may have
trouble living in a freshwater lake is that
(1) there are more carnivores in freshwater
habitats
(2) salt water holds more dissolved nitrogen than
fresh water
(3) more photosynthesis occurs in fresh water
than in salt water
(4) water concentration in the fish is affected by
salt levels in its environment

Answers

Answer:

(4)

the freshwater will, through osmosis, enter the fish, causing its cells to swell, and the fish will die.

Plssssss mark as brainliest

Water concentration in the fish is affected by salt levels in its environment.

Why a fish that lives in the ocean may have trouble living in a freshwater lake?

Fish that live in the ocean have adapted to the high levels of salt in the water, and their bodies have developed mechanisms to maintain the proper balance of water and electrolytes. When these fish are placed in a freshwater lake, the low salt concentration causes water to enter the fish's body, leading to an imbalance in the fish's internal fluids and potentially causing harm or death.

This is known as osmoregulation. This is the main reason why a fish that lives in the ocean may have trouble living in a freshwater lake.

Learn more about adaptation, here:

https://brainly.com/question/29768035

#SPJ2

There are sensory receptors located in human skin that register specific stimuli such as _________. a. happiness b. pain c. tickles d. relief please select the best answer from the choices provided a b c d

Answers

There are sensory receptors located in human skin that register specific stimuli such as b. pain

The sensory receptors contain specific nerve endings in them that detect certain changes in environmental stimuli. After the sensory receptors have detected a change in the stimuli, the neurons carry this message to the central nervous system which interprets the message from the neurons and sends a response via the effector neurons.

The sensory receptors present in the skin can help us detect pain when we hit something or when a certain part of the body faces damage. There are other stimuli that can also be detected by the skin due to the sensory receptors such as hotness, coldness etc.

To learn more about sensory receptors, click here:

https://brainly.com/question/25753221

#SPJ4

Answer: b

Explanation:

because it is

suppose an organism is extirpated from a local environment. In what way might other organisms be affected? Provide examples to support your answer.

Answers

An ecosystem's species are linked by intricate "food webs" of eaters and eaters. When a species goes extinct, neither its predators nor its prey can consume it anymore. These populations change, and others are affected. Such "cascades" of impact can be unpredictable and occasionally fatal. This would happen if an organism is extirpated from a local environment.

What does extirpated means?

Extirpation is the local extinction of a species or organism, where it/they stop existing in a specific location yet still survive elsewhere. For the survival of a species, what does extirpation mean? We limit the genetic diversity of organisms by eradicating local populations through human-mediated activities. Expungement brought on by excessive hunting, fishing, agriculture, pollution, the introduction of invasive species, and the destruction of habitat. The current loss of biodiversity brought on by humans cannot be reversed by speciation until hundreds of thousands of years have elapsed since the evolution of new species is a lengthy process. The International Union for Conservation of Nature (IUCN) formally proclaimed magnificent forest frogs to be extinct in 2020. Unlike some species that have vanished entirely as a result of natural disasters, this species' extinction was also a result of human activity.

Examples include the whooping crane, the swift fox, and the leatherback sea turtle. a species of wildlife that once lived freely in Canada but is now extinct. Examples include the population of grey whales in the Atlantic Black-footed ferret, fish, and gravel chub a species of animal that is extinct.

To know more about extirpated, visit:

https://brainly.com/question/17404308

#SPJ9

What is an example of a molecule that functions in insulation and buoyancy?

Answers

Answer:

Lipids!!!!!!!!!!!!l!!!¡!

Lipids are an example of a molecule that functions in insulation and buoyancy.

What are Lipids?

Lipids are defined as a broad group of naturally occurring molecules which include fats, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, phospholipids, and others. Key roles of lipids include storing energy, signaling and serving as structural components of cell membranes.

Lipids include fats, oils, waxes, phospholipids, and steroids. Lipids are described as a family of organic compounds, composed of fats and oils whose molecules generate high energy and are responsible for various functions within the human body.

Thus, Lipids are an example of a molecule that functions in insulation and buoyancy.

Learn more about Lipids, here:

https://brainly.com/question/3498396

#SPJ2

Please I need help!
If glycogen or starch were hydrolyzed, the result would be the same. Many _________ molecules (name the specific molecule) would be the result.

Answers

If glycogen or starch were hydrolyzed, the result would be the same. Many glucose molecules would be the result.

What is hydrolysis?

The term hydrolysis carries with it the ide of cutting down into pieces. Image that I have this long stick that I have made by the process of jogging a lot so small sticks together. As I joining the long sticks, I have been able to make this stick that is very much long. ow I want to get back the smaller sticks that I have joined, all I need to do is to use a little knives to cut out all the sticks from the points that they were joined.

This is exactly the idea that has to do with hydrolysis. It is the breakdown of a macromolecule into the small monomers that form it. Having said this, let us remind each other that starch and glycogen are both made of glucose.

It then follows now that the hydrolysis of starch and glycogen would produce many molecules of glucose.

Learn more about hydrolysis:https://brainly.com/question/24213349

#SPJ1

officials want to collect a dna sample from a suspect, and to this end gather blood, saliva, hair, and fingernail clippings (all from this individual). dna from which of these materials will demonstrate the same sequence of nucleotides?

Answers

The aim of collecting a suspect's blood, saliva, hair, and fingernail clippings is to obtain a DNA sample (all from this individual). The nucleotide sequence in this person's DNA will be consistent throughout all of their cells.

Describe DNA.

DNA, commonly referred to as deoxyribonucleic acid, is the genetic material carried by humans and nearly all other organisms. Nuclear DNA, which makes up the majority of DNA, is located in the cell nucleus, with very little DNA being present in the mitochondria (where it is called mitochondrial DNA or mtDNA).

The DNA of an individual can be found in almost all of their cells. The cell nucleus contains the majority of the DNA. All samples of this person's blood, saliva, hair, and fingernail clippings contain the same DNA sequence. The 3 billion bases that make up human DNA are identical in more than 99 percent of people.

Therefore, in order to obtain a DNA sample from a suspect, officials must first collect blood, saliva, hair, and fingernail clippings (all from this individual). The nucleotide sequence in this person's DNA will be consistent throughout all of their cells.

To learn more about DNA from the given link

https://brainly.com/question/16099437

#SPJ9

the river near a community floods occasionally and damages homes. The town wants to investigate why the river floods. Which three factors are most important for the town to investigate?

Answers

There are three factors that are most important for the town to investigate:

Provide Education.Create flood plains and overflow areas for rivers.Create Detention Basins.

The main impact of floods. Widespread flooding can threaten lives inundate property and businesses destroy property damage critical infrastructure and disrupt access to essential public services. The effects of flooding are often long-lasting and can be very costly disruptive, and distressing for affected communities.

The most livable cities have quality public health and education systems excellent housing and excellent public transportation infrastructure. Lack of green space air pollution noise and unsafe neighborhoods contribute to the prevalence of depression in urban areas. This explains why students and young professionals are attracted to inner-city locations.

Learn more about The town investigate here:-https://brainly.com/question/13304495

#SPJ1

place these events in the correct order as they would occur in the production of atp fueled by the energy collected by photosystem ii. begin with the first event to occur at the top of the list.

Answers

In photosystem II Electrons pass along the ETC Hydrogen ion gradient is established Hydrogen ions flow through ATP synthase.

Photosystem II is the first membrane protein complex in oxygenic photosynthetic organisms in nature. It produces atmospheric oxygen to catalyze the photo-oxidation of water by using light energy. It oxidizes two molecules of water into one molecule of molecular oxygen.

Photosystem II generate ATP in the light reactions of photosynthesis. Electrons are transferred sequentially between the two photosystems, with photosystem I acting to generate NADPH and photosystem II acting to generate ATP. PSII comes first in the path of electron flow, but it is named as second because it was discovered after PSI.

To learn more about Photosystem II , here

brainly.com/question/13211869

#SPJ1

You know that all eleven body systems work together in the human body. What would happen if a system stopped working?

Answers

All eleven body systems work interdependently. If a system stopped working, the body can not maintain homeostasis (a balance among all the body systems) and all the systems will slowly shut down.

What is the role of NADPH in CO₂ reduction?

Answers

A redox pathway is represented by the dark reactions. As CO2 is reduced to glucose, NADPH gets oxidized to NADP+.

NADPH does it lessen CO2?

During the Calvin-Benson cycle, carbon dioxide from the atmosphere is transformed into glucose. Utilizing the electrons made accessible by the oxidation of NADPH, calls for the total reduction of CO2. So, a redox pathway is represented by the dark reactions. As CO2 is reduced to glucose, NADPH was oxidized to NADP+.

What function does NADPH perform?

All organisms require nicotinamide adenine dinucleotide phosphate (NADPH) as an important electron donor because it supplies the reducing energy needed for anabolic processes and redox balance. NADPH homeostasis is controlled by a variety of signaling channels and various metabolic enzymes that change adaptively in cancer cells.

Does NADH lessen CO2?

The equilibrium predicted per thermodynamic considerations, which is likewise attained from the formic acid side, is obtained during the enzyme-catalyzed CO2 reduction by NADH. The Michaelis constant with CO2 is around 40 mM, reflecting the enzyme's poor affinity for this substrate.

To know more about NADPH visit:

https://brainly.com/question/14870384

#SPJ10

iron carbonate (??) - iron oxide (56g) - carbon dioxide (44g)

Answers

The mass of iron carbonate is 291 g along with the mass of iron oxide whose mass is 56 g and carbon dioxide whose mass is 44 g.

What is mass , and it's unit gram and what is the mass of iron carbonate?As always studies mass if the amount of matter present in the given object and asset.Also it is truly said that greater the mass of the body ,smaller is the change produced by applying force on the body.Everything we , our eyes witnesses around have a certain amount of mass as a contained quantity.This is only due to mass that we call a body light weighed or heavy body.The mass of iron oxide is 56 gram as FeO = Fe+O = 56 gram , likewise carbon dioxide have the mass 44 gram.

To know more about mass visit:

https://brainly.com/question/19694949

#SPJ9

Good grades are not as important as experience when it comes to building a career in marine science.

True

False

Answers

Answer:  The correct answer is false

Explanation:

College degrees and solid GPAs are important to many professional careers within marine science. This answer was confirmed correct on edge as well!

Explain why there are rings of cartilage around the trachea.

Answers

Answer:

The primary function of the rings is to support the trachea from collapsing in on itself when there is no air being inhaled/exhaled.

Hope that helps

write the definition of plant cells.
-must be full of nessecary info
-must include 3 paraghs​

Answers

Plant cells are eukaryotic cells that have a real nucleus and specific organelles to perform specialized functions. However, plant cells do have a number of organelles that are distinct from those found in other eukaryotic cells.

What are the benefits of eukaryotic cells?

Because they can sustain multiple habitats within of a single cell, eukaryotic cells can carry out complex metabolic reactions that prokaryotic cells cannot. In reality, this contributes significantly to the fact that eukaryotic cells can grow to sizes that are several times bigger than those of prokaryotic cells.

What four types of eukaryotic cells are there?

Plants, animals, fungus, and protists are a few examples of eukaryotic cells. Their genetic material is organized by chromosomes. The Golgi body, organelles, golgi apparatus, and nucleus are all present in eukaryotic cells.

To know more Eukaryotic cells visit:

https://brainly.com/question/11351358

#SPJ9

Audrey bought various vegetables at the supermarket and brought them home but not to eat. She put a stalk of celery in purple-dyed water to observe its_________. She then observed the tuber roots of potatoes and their_________

Answers

She put a stalk of celery in purple-dyed water to observe its capillary action. She then observed the tuber roots of potatoes and their eyes.

Capillary action is the system of a liquid flowing in a slender space without the assistance of, or even in opposition to, any outside forces like gravity.

Capillary action is the movement of water in the spaces of a porous cloth due to the forces of adhesion, cohesion, and floor anxiety. It's miles the ability of a liquid to float in narrow spaces without the assistance of, and every now and then in competition to, outside forces like gravity.

It happens because of intermolecular forces among the liquid and surrounding stable surfaces. If the diameter of the tube is adequately small, then the aggregate of surface anxiety, that is as a result of cohesion in the liquid and adhesive forces among the liquid and field wall act to propel the liquid.

Learn more about capillary action here:- https://brainly.com/question/14457491

#SPJ1

Water boils and becomes a gas at 100°c .What are the states of sodium ,chlorine and sodium chloride at 100°c ?

Answers

Answer:

NaCl will be left after 100C. Because sodium will actively react with water and disappear. Chlorine is gaseous at room temperature. Water will evaporate and sodium chloride will left because of condensation.

Explanation:

Hope it helps! =D

when a double-stranded dna molecule is exposed to high temperature, the two strands separate, and the molecule loses its helical form. we say the dna then has been denatured. (denaturation also occurs when dna is exposed to acid or alkaline solutions.)

Answers

The A-T-rich regions denature first because-

A-T base pairs only have 2 hydrogen bonding.

C-G base pairs have 3 hydrogen bonding.

What is hydrogen bonding?

Instead of forming a covalent bond with an atom of hydrogen, hydrogen bonding is a specific form of dipole-dipole attraction between molecules. It comes about as a result of the attraction between a hydrogen atom that is covalently attached to a very electronegative atom, like an N, O, or F atom, and another extremely electronegative atom. Strengths of hydrogen bonding per mole range from 4 kJ to 50 kJ. The fact that water has a high boiling point (100 °C) compared to the other group-16 hydrides, which have significantly weaker hydrogen bonds, is specifically due to intermolecular hydrogen bonding. The secondary and tertiary structures of proteins and nucleic acids are in part due to intramolecular hydrogen bonding. It also has a significant impact on the structure of polymers, both man-made and organic.

To learn more about hydrogen bonding with the help of given link:

https://brainly.com/question/1426421

#SPJ9

The complete question is-

"When a double-stranded DNA molecule is exposed to high temperature, the two strands separate, and the molecule loses its helical form. We say the DNA has been denatured. (Denaturation also occurs when DNA is exposed to acid or alkaline solutions.)

a. Regions of the DNA that contain many A-T base pairs are the first to become denatured as the temperature of a DNA solution is raised. Thinking about the chemical structure of the DNA molecule, why do you think the A-T-rich regions denature first?"

Can someone help me identify what the parts of this (40x) magnified (thicket creeper) leaf is??

Answers

The parts of the above leaf magnified are called "veins" or Phloem. A more scientific group name is "Vascular Structure"

What comprises the vascular structure of a leaf?

The xylem, which transfers water and dissolved nutrients from the roots to the leaves, and the phloem, which delivers food from the leaves to all sections of the plant, are the two principal vascular tissues.

The phloem is the vascular tissue in responsible of organic nutrition transfer and distribution. The phloem serves as a signaling system as well as a structural role in the plant body.

It is normally made up of three types of cells:

sieve components, parenchyma, and sclerenchyma.

Learn more about leaves:
https://brainly.com/question/1071271
#SPJ1

basepair the codons to the anticodons 3 ′ gcg 5 ′, 3 ′ acc 5 ′, and 3 ′ agg 5 ′, taking the wobble hypothesis into account. there may be more than one answer choice per anticodon. not all answer choices will be used.

Answers

Anticodon: 3' GCG 5'⇒ Codons: 5' CGC 3' and 5' CGU 3'

Anticodon: 3' ACC 5'⇒ Codon: 5' GUG 3'

Anticodon: 3' AGG 5'⇒ Codons: 5' UCU 3' and 5' UCC 3'

What is its anticodon?

During protein synthesis at a ribosome, a triplet of dna nucleotides in transfer RNA that specifies the amino acid transported binds to a complementary codon in messenger RNA.

What use do codons and anticodons function?

An mRNA codon is a triplet or triple-nucleotide sequence that codes for a specific amino acid during translation. A three-nucleotide region called the anticodon is present on tRNA and binds to the corresponding mRNA sequence. The anticodon made explicit which amino acid is delivered by the tRNA molecule.

To know more about Anticondon visit:

https://brainly.com/question/14448051

#SPJ9

Scientist captured tagged and released 100 wild dogs. two years later scientist captured 45 wild dogs and 10 were already tagged. what is the population of wild dogs

Answers

The population of wild dogs is 135.

From the data given above:

The scientist's first capture = 100 dogs

The scientist's second capture 2 years later = 45

10 out the 45 wild dogs the scientist captured 2 years after had already been tagged 2 years before.

Therefore:

Total population = No of wild dogs captured, tagged and released + No of wild dogs captured 2 years later - No of wild dogs that were already tagged during the second capture

Total population = 100 + 45 - 10

Total population = 135

Learn more on population from:

https://brainly.com/question/27991860?referrer=searchResults

#SPJ4

snail, like humans,perform cellular respiration to obtain energy. what gas do snails need as an input to perform cellularrespiration to obtain energy. what gas do snails need as an input to perform cellular respiration?

Answers

The gas that snails need as an input to perform cellular respiration and thus obtain energy is oxygen.

What is cellular respiration?

Cellular respiration is a chemical process in which aerobic cells use oxygen to produce energy in the form of ATP. During cellular respiration, oxygen acts as an acceptor of electrons during the electron transport chain, a key cellular process to generate energy by coupling it with a proton gradient and the work of ATP synthetase.

Therefore, we can conclude that oxygen is a fundamental gas that is required to carry out oxide reduction reactions in cellular respiration.

Learn more about cellular respiration here:

https://brainly.com/question/7719956

#SPJ1

n the chemical equation for photosynthesis, carbon dioxide and water are converted to glucose and oxygen.

6CO2 + 6H2O ® C6H12O6 + 6O2

Which component could be added to complete this chemical equation?
light energy
ATP and NADPH
chemical energy
rubisco

Answers

In order to complete this reaction in the way that it have been Shown in the question, then we need to add the components; ATP and NADPH

What is photosynthesis?

The term photosynthesis is used to define the process by which the green plants produce their own food in the presence of sunlight and chlorophyll. In this process, there is the combination of the carbon dioxide and the water molecules which is catalyzed by light from the sun.

We are now trying to see what is going to complete the reaction as shown. We must know that the reaction requires ATP and NADPH to be complete.

Learn more about photosynthesis:https://brainly.com/question/1388366

#SPJ1

Answer: ATP and NADPH

Explanation: W

whatisphotosynthesis​

Answers

Answer:

Photosynthesis is the procedure in which plants (organisms with procaryotic cells) convert water, sunlight, carbon dioxide (the air animals produce from exhaling) and nutrients from the soil into their food.

Answer:

photosynthesis is the process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water

Heart disease is the leading cause of death among both men and women in the United States.
It is usually caused when a sticky substance called plaque builds up in the arteries. Often, the
only symptoms of heart disease are chest pain or discomfort.
Why do you think heart disease is so prevalent in the United States? How could heart
disease affect other
organ systems?

Answers

Heart Diseases prevalent in the United States due to the leading causes of High blood pressure, a High Cholesterol level, diabetes, Overweight and obese, Alcohol overuse are the key factors.

Heart disease could affect other organs as if the heart is weak, blood could not be circulated and pumped properly thus fluid will start filling in kidneys, lungs, stomach, etc. cause swelling in ankles in feet or legs.

Coronary heart disease is most common cause of death, data suggests that over 20.1 million adults age 20 and older have CAD. CAD can occur when arteries that supply blood and oxygen to heart becomes clogged due to fatty materials called plague. Such factors results sudden Cardiac arrest.

Learn more about Heart disease here  https://brainly.com/question/24053461

jeremy, a patient in the neurology unit, is having a seizure (uncontrolled activity of brain neurons). to stop the seizure, his nurse administers a drug through his intravenous line. this drug is one of a group of drugs called benzodiazepines. benzodiazepines enhance the action of the neurotransmitter gaba by increasing how strongly it binds to its receptors. gaba, in this case, is an inhibitory neurotransmi

Answers

In the given case, an inhibitory neurotransmitter opens ion channel for chloride ions, for the entry of neurons, which hyperpolarizes the neurons, and it makes neurons less likely to do action.

What are neurons?

The components of the nervous system are known as neurons; these branch-like cells resemble the roots of a plant and hold the information that is absorbed by electrical impulses and transported to various parts of the brain.

The brain and hypothalamus are parts of the central nervous system, and all of the neuron cells are part of the peripheral nervous system.

Thus, the correct options are e, a, and c.

To learn more about neurons, refer to the link:

https://brainly.com/question/24217914

#SPJ1

The question is incomplete. Your most probably complete question is given below:

Jeremy, a patient in the neurology unit, is having a seizure (uncontrolled activity of brain neuronte stop the seizure, his nurse administers a drug through his intravenous line. This drug is one of a good of drugs called benzodiazepines. Benzodiazepines enhance the action of the neurotransmitter GABA by increasing how strongly it binds to its receptors. GABA. In this case, is an inhibitory neurotransmite that opens ions channels that allow to enter neurons. As a result, the neurom This makes it likely that neurons will fire an action potential and to helps end the seizure

hyperpolarize

potassium ions

less

more

chloride ions

depolarize

sodium ions.

genotype and allele frequencies describe the gene pool of the population. can only be calculated where there are two alleles at a locus. describe the genetic structure of the population. are always determined by counting every individual in the population. are used to know how many individuals live in the population.

Answers

Genotype and allele frequencies describe the genetic structure of the population., and describe the gene pool of the population.

An organism's genotype is made up of all of its genetic components. The term "genotype" can also refer to the alleles or variants that a person possesses in a specific gene or genetic region. By dividing the total number of copies of all the alleles at that specific genetic locus in the population by the number of times the allele of interest is observed in a population, an allele frequency can be computed.

A fraction, a percentage, or a decimal can be used to express allele frequencies. From the time of embryonic development to adulthood, an individual's genotype determines their inherited potentials and restrictions.

To know more about genotype refer to: https://brainly.com/question/12116830

#SPJ4

you heat kill "virulent" type iiis pneumococcus, homogenize this mixture and then treat it with rnase. next, you incubate this mixture with "avirulent" type iir pneumococcus and then inject the bacteria into live mice. do you expect the mice to get sick? why or why not?

Answers

Pneumococcus of type IIIS (virulent) is killed by heating the mixture, which is subsequently homogenized  and the bacteria are subsequently injected into living mice.

When the IIIS bacteria are treated with DNase and heated to death. DNA will then breakdown as a result of DNase. The living IIR bacteria cannot undergo any changes or transformations as a result of this DNA. Mice won't perish. Because DNA is the transforming principle and the DNase degrades DNA, this occurs. DNA is responsible for turning virulent organisms into non-virulent ones.Any infection brought on by the pneumococcus, also known as Streptococcus pneumoniae, is known as pneumococcal disease (noo-muh-KOK-uhl). Ear, sinus, and bloodstream infections can all be caused by pneumococcal infections, as well as pneumonia.Of healthy individuals, 5 to 90% may have the bacteria in their nasopharynx.

To know more about virulent here

https://brainly.com/question/13552511

#SPJ4

Other Questions
Which of the following is probably a reason Ashley does her homework early in the day and on the kitchen table? what where 3 names english civil war a company has the following products in its ending inventory. compute lower of cost or market for inventory applied separately to each product productquantitycost per unitmarket per unit product a10$ 724$ 694 product b15$ 524$ 564 product c20$ 674$ 699 multiple choice $28,280. $1,922. $1,957. $28,580. $29,380. Please look at the photo and help me please or Ill get a F All you need to do is find the error out of the 3 choices and tell me what is the error PLEASE AND THANK YOU HELP ASAP 30 POINTS 9TH GRADE MATH. WILL GIVE BRAINIEST IF CORRECTSolve.Question 1.-4x + 17 9.Question 2. | 5 + z | + 3 = 10.Question 3.Match to the correct one 5y + 2 = 5y + 8. 1. All real numbers2 (y + 4) = 2y + 8. 2. No solutions 5y + 2 = 2y + 8 3. Infinity many solutions. Question 4.Solve for x.x - 4 5. SHOW YOUR WORK.question 5.solve for x.12x = 4 (2x -3) - 12.SHOW YOUR WORK.Question 7.Solve for x3(x + 2) = 3x + 2 The Christian Coalition is best described as a(n)O public interestO ideologicalO laborO professionalgroup. The perimeter of a college basketball court is 96 meters and the length is 14 meters more than the width. What are the dimensions? When marketers evaluate the attractiveness of each potential segment and decide in which of these groups they will invest resources to try to turn them into customers, they are engaging in ________. Mike says the opposite of 5 is 5 and the absolute value of 5 is 5. Is he correct?Use the drop-down menus to explain your answer.Mike Choose... correct. Choose... combine to make zero. Choose... is the distance from zero. a rod consisting of two cylindrical portions ab and bc is restrained at both ends. portion ab ismade of steel, and portion bc is made of yellow brass. if the rod is initially unstressed, determine the compressive force induced in abc when there is a temperature rise of 50c Find the sum of the first 31 terms of the following series, to the nearest integer. 4, 11,18,... 4,11,18,... 1What is the irony is the story the happy prince? Which of the following was a settler least likely to see on a Sunday in Pennsylvania?O a person studying the BibleO a person selling farm goodsO a person attending a Christian servicea person praying in their home (x-5)^2/8+(y+1)^2/32=1Solve for the four vertices Based on Columbus'journal, what were hisintentions for the NativAmericans? What is the mass of the nucleus? The retail cost of a TV is 10% more than its wholesale cost. Therefore, the retail cost isThe retail cost istimes the wholesale cost. Briefly explain one specific historical difference between the cultural life in the American colonies under British rule and life is the newly independent United States. The force, F (Newtons), between two objects is inversely proportional to the square of the distance, d (metres), between them. The force is 0.084 Newtons when the distance between the objects is 3 metres. Work out d (rounded to 2 DP) when F = 0.029 Newtons. M2 U2 Practice 6Given: the equation of line lis y = -x +4Write the equations of the lines passing through the point (6,7) that are (a) perpendicular to line I, and (b) parallel toline l.