What happens to the sugar that are made during photosynthesis?

They go back into the Calvin Cycle
They can be used for cellular respiration
They move directly into an electron transport chain
They bond to make ATP

Answers

Answer 1

Answer:

B - They can be used for cellular respiration.

Explanation:

The sugar goes through the process of cellular respiration and is used to make energy in the form of ATP.

First it must be used in cellular respiration, then can be formed into ATP.

Hope this Helps!

Have a great day!

:)


Related Questions

This model shows how cold winter air is warmed in the Great Lakes Basin, which creates ideal temperatures for year-round
fruit farming, which statement best describes this interaction?
A)
B)
The biosphere and hydrosphere interact, which affects the
atmosphere
The geosphere and atmosphere interact, which affects the
hydrosphere.
The hydrosphere and atmosphere interact, which affects the
biosphere.
The geosphere and hydrosphere interact, which affects the
atmosphere
C)
D)

Answers

Answer:  C aka “the hydrosphere and the atmosphere interacts which affects the biosphere“

Explanation:

Hydro means water right...  your welcome babes!!!

Spheres are the division of the air, land, water and living organism and their interactions. Interaction of hydrosphere with atmosphere affects the biosphere.

What are the types of the spheres and their relation?

The spheres of the air and the constituents of the gases in the planet's surface is called the atmosphere and the water environment and its constituents are called hydrosphere. The sphere where the living organisms resides is called the biosphere.

The air and the air movement of the atmosphere along with the lake conditions or the hydrosphere affects the lives of the organism of the biosphere.

The fruits and the other vegetation is part of the biosphere and gets affected by the air from the atmosphere and the water cycle of the lake from the hydrosphere.

Therefore, option C. interaction of the hydrosphere and atmosphere affects the biosphere.

Learn more about the hydrosphere and biosphere here:

https://brainly.com/question/11591550

which process in photosynthesis uses energy from the sun

Answers

Answer:

splitting water into hydrogen and oxygen

Explanation:

because

The light-dependent reaction

          The light-dependent reaction, as its name implies, occurs inside the thylakoid membrane and necessitates a constant supply of sunshine. The light waves' energy is captured by the chlorophyll and transformed into chemical energy in the form of the molecules ATP and NADPH.

What is Photosynthesis ?

           Plants and other living things employ a process called photosynthesis to transform light energy into chemical energy that can then be released through cellular respiration to power the organism's activities. Despite the fact that various species undertake photosynthesis in different ways, the process always starts when proteins called reaction centres that contain green chlorophyll absorb energy from light. Unlike bacteria, which have these proteins incorporated in the plasma membrane, plants store these proteins in organelles called chloroplasts, which are most prevalent in leaf cells.

         When the cell needs energy, ATP can be taken out and used to fuel processes or stored for use in later ones. Animals use ATP to retain the energy released during meal digestion. Similar to this, plants use ATP molecules to store the energy they obtain from light during photosynthesis.

          In addition to converting ADP to ATP, photosynthetic processes are used by plants to absorb, process, and store solar energy. Animals convert ADP to ATP, which can subsequently be utilised to drive essential development and cell maintenance, using the energy supplied from the breakdown of glucose and other molecules.

           Plants absorb water (H2O) and carbon dioxide (CO2) from the soil and atmosphere during photosynthesis. Water is oxidised, which means it loses electrons, while carbon dioxide is reduced, which means it receives electrons, inside the plant cell. Water is converted into oxygen and carbon dioxide into glucose as a result.

To learn more about Photosynthesis refer :

brainly.com/question/19160081

#SPJ2

name one human hormone that is produced by genetically modified bacteria​

Answers

Answer:

Insulin

Explanation:

I knew the answer, but I'm not really good at explaining these so I got a little help from google. -------- Bacterial cells can be genetically modified so that they have the gene for producing human insulin. As these modified bacteria grow, they produce human insulin.

Which of the following statements about meiosis is true?

Meiosis creates unique cells.

Meiosis creates identical cells.

Meiosis creates cells such as skin and muscle cells

Meiosis creates glucose in plant cells

Answers

Answer:3

Explanation:

SOMEONE HELP ME PLZ!!!!!!!!!!!!

Answers

Mitochondria gives energy so it’s the power plant of the cell.


What causes this change in fur color?

Answers

Hair dye does .jason doe doe did dows

Which of the following is an example of evolution that can be studied firsthand by
scientists while it happens (meaning that scientists have opportunities to perform
experiments and to measure the outcome)?
A) The gradual decent of whales from tetrapod (four-legged) land mammal
ancestors
B) A dog shedding its thick winter fur so that it can stay cooler in the summer
C) The acclimation of a person's body to the low oxygen atmosphere at high
altitudes
D) The development of antibiotic resistance in bacteria

Answers

Answer:

c.

Explanation:

The acclimation of a persons body to the low oxygen atmosphere at high altitudes

Robert Hooke discovered cells in the 18th century.
true or false

Answers

Answer:

False it is in the 17th century (1665)

Explanation:

He named the little blocks after cells (little rooms)

False it was discovered in the 17th century

Put the boxes in the correct order

Answers

Answer:

This was the question you asked earlier and you deleted it after i wrote a whole essay so here. I hope its still of some use.

Explanation:

I believe the most useful ap to use for people of age is Faceb00k. Faceb00k is a safe and friendly app where people can share what there doing or pictures.

So many parents and grandparents use this today to share photos of younger family members, and others can like and comment on there posts. Although their are some who receive hate, most of the people are quite rather friendly.

People like to share there appreciation for l0ved ones by letting the whole world see them through Faceb00k. Most elderly people do this so there younger ones can look back at all the memories they had together. Yes, its true they can just not post it and still look back at memories, but they post it because if it gets deleted and you posted the photos online there will always be a way to recover them.

In conclusion, this is why I believe Faceb00k is the best ap for the more elderly people. Firstly, they can show there memories to the world by showing appreciation. And lastly, whenever you post something online it can always be recovered, so those valuable moments will not be forever lost.

How is the energy produced by respiration stored? (Googled answers will be reported) (actual answers please)

Answers

Answer: Energy is produced by respiration because its stored within the cells in the form of ATP (Adenosine Triphosphate) .

Explanation:

I'm pretty sure that's it.

- Sorry if I'm wrong :<

which enzyme attaches the ozaki fragments?

Answers

Answer:

DNA ligase,joins the okazaki fragments together into a single DNA molecule

Answer:

DNA ligase attaches the ozaki fragments.

Explanation:

In my thought it's the answer.

List and describe the different types of connective tissue. What similarities and differences did you observe?

Answers

Answer:

There are three types of connective tissues, loose connective tissues, dense, and hyaline.

Explanation:

The difference between them is the composition of the extracellular matrix that surrounds the fibroblast, that is to say that in loose connective tissue, the function will be of support or filling, and the fibroblast is immersed in an extracellular matrix with a high content of water and proteins. collagen.

On the other hand, in dense connective tissue, the amount of collagen fibers is greater, the protein structure as well, and the interlacing between proteins is more complex, and they may also have the ability to calcify as in the case of bone tissue or cartilage.

Finally, we have the hyaline connective tissue, which is very rich in hyaluronic acid and is found in the joints forming the discs, which are shock absorbers and protectors from bone wear due to friction between surfaces, hyaluronic acid, proteinglycans and glycoproteins are the main protagonists of all connective tissues together with the fibroblast, but even more so in the hyaline connective.

Atoms of A decay to atoms of B with a half-life of 200,000 years. If there are 20,000 atoms of A to begin with, how long will it take for there to be 2,500 atoms of A?

Answers

Answer:

The correct answer is: 600,000 years

Explanation:

Half-life is the time which is essential or required to decrease a specific substance to half of its initial amount of the substance. So, if a substance has a half-life of 200,000 years then it means it takes 200,000 years to decrease or change into a new substance and remain half of its initial quantity.

half-life              amount

     0                  20000

     1                    10000          

     2                    5000

     3                     2500

total half-life = 3 to 2500 atoms of A

so, the time will be = 3 * 200,000 years

 = 6000000

In which form food is stored in the leaves? Comment

Answers

the answer is starch

Explanation:

food is stored in the leaf in form of starch in plants

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer:

what I don't understand what is the Ctcagt

Consider the food chain grasshopper mouse snakes hawks. If snakes go extinct what will happen to the food chain

Answers

Answer:

This can actually cause a major problem if the number of grasshoppers were to increase out of control. They eat plants and the number of plants,which are the basis of the food chain, could severely decrease which would impact all of the levels operating above this trophic level.

Answer:

Lack of mice

Explanation:

If the grasshopper where to go extinct the mice population would decrease. Which would lead to it being harder for snakes to find food or they would begin to rely on a different food source. But the hawks would be able to find less snakes but would overall be fine.

What do the dotted lines, indicated with the arrow, represent in the DNA model above?

The junctions of codons between individual strands
The bond between deoxyribose molecules and phosphates
The monomers that make up a polymer
The hydrogen bond between complimentary nucleotides

Answers

Answer:

The hydrogen bond between complimentary nucleotides.

what makes stem cells different from cells in the body

Answers

Answer:

Stem cells are the body's raw materials

Explanation:

Stem cells are the body's raw materials — cells from which all other cells with specialized functions are generated. Under the right conditions in the body or a laboratory, stem cells divide to form more cells called daughter cells.

Stem cells are different from the other body cells as these are unspecialized cells which can undergo division and renew on their own. The stem cells can undergo specialization by the process of cellular differentiation.

What are Stem cells?

Stem cells can be defined as the body's raw materials. These are the cells from which all the other cells with specialized functions are generated.

Embryonic stem cells are the pluripotent stem cells derived from the inner cell mass of a blastocyst. Blastocyst is an early-stage pre-implantation embryo. Human embryos reach the blastocyst stage in 4 to 5 days post fertilization, at which time they consist of 50 to 150 cells.

Stem cells are different from the other cells in the body in three ways which are the stem cells can divide and renew themselves over a long time. Stem cells are unspecialized cells, so they cannot do specific functions in the body unless they undergo cellular differentiation. Stem cells have the potential to become specialized cells, such as muscle cells, blood cells, and brain cells by undergoing cellular differentiation.

Learn more about Stem cells here:

https://brainly.com/question/25584485

#SPJ2

The creation of different breeds of dog by humans is an example of...
A) stabilizing selection
B) disruptive selection
C) artificial selection
D) sexual selection

Answers

Answer:

I believe it is artificial selection

Explanation:

i learned about this a little while ago lol

We find DNA on the ___, In every living cell that an organism owns
a. chromosomes
b. reproduction
c. mitosis

Answers

Answer:

A. Chromosomes

Explanation:

A Chromosome is some thing carrying genetic information in the form of genes.

We find DNA on the chromosomes, in every living cell that an organism owns. So, the correct option is A.

What is Chromosome?

The word chromosome comes from the Greek words for color (chroma) and body (soma). Chromosomes are so named because they are cell structures, or bodies, that are strongly stained by certain color dyes used in research.

Chromosomes are defined as structures found inside the nucleus of a cell that are organized into genes from proteins and DNA. Each cell normally has 23 pairs of chromosomes.

These are threadlike structures which are made of protein and a single molecule of DNA that serve to carry the genomic information from cell to cell.

Therefore, the correct option is A.

Learn more about Chromosomes, here:

https://brainly.com/question/10234301

#SPJ6

Calculate the force needed to cause a 6 kg bowling ball to accelerate 20 m/s2.

Answers

Answer:

120N

Explanation:

F=ma

120N=6kg(20m/s^2)

please help me with this question:)

Answers

That is the nucleus!

Hope this helpeddd

Answer:nucleus :)

Explanation:

Which choice below is an example of humans modifying the physical environment?

Farmers clearing land to plant

Transportation improvements

Commercial development

Industrial development

Answers

Industrial development!

Which are properties of metals? Check all that apply
Dullness
Malleability
Ductility
Poor conductors of heat
Good conductors of heat

Answers

Metals are malleable
Metals are ductile
Metals are good heat and electricity conductors
Metals lose electrons in reactions.

Answer:

2,3, and 5

Explanation:

got it right on edge

True or false?

An apple, potato, and onion all taste the same if you eat them with your nose plugged

Answers

Answer:

True

Explanation:

Answer:

True

Explanation:

It is frequently quoted that upwards of 80% of our taste is made up by smell. So if you plug your nose and cover your eyes, the taste between an apple and onion should be indistinguishable. Potato's will also taste the same .

Which phase of the Moon rises in the east as the Sun rises in the east

Answers

Answer:

Rise, Transit and Set time

Explanation:

What effect with the enzymes have on the time to make 1 MG of product

Answers

Answer:

Decreases

Explanation:

Enzymes speed up chemical reactions so the product is made in less time

A 67-year-old was previously diagnosed with rheumatic heart disease. Tests now reveal lipoprotein deposition with chronic inflammation that impairs blood flow from the left ventricle into the aorta. Which diagnosis does this history support?

Answers

Answer:

Aortic stenosis

Explanation:

Aortic stenosis is one of the most common cardiovascular diseases. This disease is caused by the narrowing of the aortic valve opening, thereby restricting blood flow from the left ventricle to the aorta. Symptoms of aortic stenosis include, among others,  heart palpitations, swollen feet, chest pain, breathing difficulties, sleeping difficulties, chronic fatigue, etc. Aortic stenosis may be cured by transcatheter aortic valve replacement, which is a minimally invasive surgical technique that allows to replace the narrowed aortic valve.

The two kinds of cells are Prokaryotes and Eukaryotes. How are they
different? *
O Prokaryotes have a nucleus.

OEukaryotes have a nucleus.

O Prokaryotes are plant cells

оThere is no difference.

Answers

Eukaryotes have nucleus and protaryotes have plant calls that’s the difference

Explain how photosynthesis and cellular respiration work together.

Answers

Answer:

photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

Other Questions
EXITTICKET:If a car travels 50 m/h , for 5 hours, then how far did the car travel ? (Distance: time. .speed) When markets fail, public policya. can do nothing to improve the situationb. can potentially remedy the problem an increase economicefficiency.c. can always remedy the problem and increase economicefficiency.d. can in theory, remedy the problem, buy in practice, publicpolicy has proven to be ineffective 9 A book publishing company selected 30 out of 50 books submitted for publishing.What decimal is equivalent to the fraction of books selected for publishing? When asked to write the domain for the equation y= |x - 6| + 3, Mary wrote the Domain is y < 3. What mistake(s) did Mary make? Write the correct domain for Mary using inequality notation. Explain to Mary how you found your answer. Alcohol is implicated in a very large amount of road collisions because it leads to slow reflexes problems with vision and loss of self-control true or false Natural _______is a mechanism for the evolution of a population to become better adapted for survival in a specific environment. The population of a city increases by 5% every year. If its population today is 300,000, what will its population bein 2 years? A computer technician charges $190 for a 3-hour appointment and $370 for a 7-hour appointment. Which of these represents a linear function that models the charge for hiring the technician for x hours?A y = 55x + 190B y = 55x + 45C y = 45x + 190D y = 45x + 55 Look at the pictures below. What can you say about them? Describe their similarities and differences Ann bought a hat for $16.20, a discount of 30% off. She paid 8% for tax how much was the total? What are two different perspectives of the American Revolution? choose the graph that represents the point on the coordinate plane. P (0,8) PLEASE HELP ME I DON'T KNOW THE ANSWER WILL GIVE BRAINLIESTThe disease that causes difficulty breathing, coughing, wheezing, and constriction of the bronchial airways is called: What is the difference between domestic and international business? Give an example of a company for each. explain how the nation's expansion/growth from 1790 to 1860 was reflected in printed materials. have you ever have a dream that you that Inventors have worked for centuries to create various musical machines.TrueFalse Which of the following delegates to the house of representatives is a voting member? A pressure antinode in a sound wave is a region of high pressure, while a pressure node is a region of low pressure.TrueFalse . In 2000, the population of Dallas was 1,188,580. Round that numberto the nearest hundred thousand.b. Round 3.14159 to four decimal places.. The price of regular unleaded gasoline was $2.19 Round that priceto the nearest cent.d. ESTIMATE Estimate the height of the ceiling in your classroom inmeters and in feet... Estimate the sum of 3879 and 5276.1. Estimate the product of 121 and 9.75 by rounding each number to thenearest whole number before multiplying.D. EVALUATE Gus works 39 hours for $9.85 per hour. He calculates thathis weekly paycheck should be $38,415. What is a reasonableestimate of what Gus earns? How do you suppose Gus arrived at hiscalculation?h. A rectangular room is 11 feet long and 10 feet wide. Gracecalculated the area to be about 124 square feet. Explain why hercalculation is or is not reasonable.1. It is 6:05 p.m, and Eduardo is driving to Dallas. If he is 157 miles awayand driving at an average speed of 62 miles per hour, is it reasonablethat he can reach Dallas by 9:00 p.m.? Explain your answer.