Which describes the relationship between the frequency wave length and speed of a wave is a wave travels through different media
No links

Which Describes The Relationship Between The Frequency Wave Length And Speed Of A Wave Is A Wave Travels

Answers

Answer 1

Answer:

a

Explanation:

as speed changes wavelength changes but frequency remain constant


Related Questions

How does a substance cross the cell membrane in diffusion?
a- flowing down the concentration gradient
b- binding to a carrier protein
c- going through a pump
d- going through a channel protein
(ck-12)

Answers

Answer:

A

Explanation:

What are characteristics that are unique to wetlands?

Answers

Answer:

  Wetlands must have one or more of the following three attributes: 1) at least periodically, the land supports predominantly hydrophytes; 2) the substrate is predominantly undrained hydric soil; and 3) the substrate is saturated with water or covered by shallow water at some time during the growing season of each year.

Explanation:The minimum essential characteristics of a wetland are recurrent, sustained inundation or saturation at or near the surface and the presence of physical, chemical, and biological features reflective of recurrent, sustained inundation or saturation.

5. What natural phenomenon converts nitrogen into the form which organisms can use?

Answers

Answer:

the nitrogen cycle

Explanation:

21. Three different processes are occurring in the drawing below. Name each process and describe it.

Answers

Answer:

Process A is diffusion

- diffusion is the random movement of molecules from the area where there is more of them to an area where there is a few of them without the input of energy.

Process B is facilitated diffusion

- facilitated diffusion is the transport of substances across a cell membrane from an area of higher concentration to a lower concentration with the help of Transport protein

Process C is active transport

- A ctive transport is when an input of energy is required to move materials through a cell membrane .

what do you call an organism that has been genetically engineered to contain a gene from a different species?

Answers

Answer:

A transgenic, or genetically modified, organism is one that has been altered through recombinant DNA technology, which involves either the combining of DNA from different genomes or the insertion of foreign DNA into a genome.

Explanation:

Answer:

This would be called a transgenic or genetically modified organism.

Explanation:

A transgenic or genetically modified organism is one that has been altered through something called recombinant DNA technology. Which involves either the combining of DNA from different genomes or in another case the insertion of foreign DNA into a genome.

the age of a woolly mammoth can be determined by examining what?

Answers

Answer:

examining the tusks, bones, teeth, (carbon levels in tissues depends)

Explanation:

Carbon-14 can be used to date the remains of dead organisms because all living things use carbon to build tissue.

The biological age of mammoths (also known as the "age at death") is usually estimated by comparison to correlations between the biological age and the wear stages of grinding teeth in extant elephants. As tusks grow, they continually incorporate ingested strontium (Sr), and the incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to investigate proboscidean movements

scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends)

What are Mammoth?

All living things need carbon to create tissue, making carbon-14 a useful tool for dating the remains of deceased species.

Mammoths' biological age, also known as the "age at death," is typically calculated by comparing it to correlations between that age and the phases of tooth wear in living elephants.

The incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to study proboscidean movements as tusks continuously integrate ingested strontium (Sr).

Therefore, scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends).

To learn more about Mammoth, refer to the link:

https://brainly.com/question/24163999

#SPJ2

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

skeletal muscle exhibits alternating light and dark bands called

Answers

Skeletal muscle exhibits alternating light and dark bands called a sarcomere

Skeletal muscle is having sarcomere having myofibrils which appear dark and light in the microscope.

What is skeletal muscle?

Only thin filaments containing actin are present in isotropic bands, anisotropic bands are the darker bands (A bands).

Repeating sarcomere sections, which are visible under the microscope as alternating dark and light bands, make up myofibrils.

When a muscle contracts or relaxes, long, fibrous protein filaments called sarcomeres glide past one another. Because of this, skeletal muscle is also known as striated muscle.

Therefore in appearance due to myofibrils composed of the sarcomere look light and dark bands in the skeletal muscle under a microscope.

Learn more about skeletal, here:

https://brainly.com/question/29215804

#SPJ2

How is the word Representation used in a sentence

Answers

Answer:

A graphical representation of results is shown in figure 1. 17. He gave a talk on the representation of women in 19th-century art. ... He is writing a book on the representation of woman in medieval art

The painting is a representation of a storm at sea.

OR

Representation is the act of speaking on someone's behalf, or depicting or portraying something. When a lawyer acts on behalf of a client, this is an example of representation.

Explain your observations. What did you observe as you added phenolphthalein to the ammonia solution? What did you observe when vinegar was added?

Answers

Answer:

Liquid ammonia is liquefied ammonia and is basic in nature. It dissolves in water to give ammonium hydroxide which ionizes to give hydroxyl ions. Therefore it turns red litmus blue and phenolphthalein solution pink.

quién me ayudaría a hacer este crusigrama
gracias ​

Answers

Answer:

Respuesta: hola ami me parece que ya lo hiciste pero te dejo ejemplos:

Explicación: 1.Venezuela

2. Sanclemente

3. Marroquin    

me das corona plis chau

Explanation:

all female mammals have one active x chromosome per cell instead of two. what causes this?

Answers

Answer:

maybe its because of pregnancy

Explanation:

The cell membrane is said to be semipermeable because

Answers

Answer:

The membrane is selectively permeable because substances do not cross it indiscriminately.

Explanation:


Concentration of water in a solution outside the cell is 30% The concentration of
water inside the cell is 70%. In what direction will the solvent move if diffusion
occurs? Is energy required?

Answers

Answer:

water will move out of the cell,energy is required

Explanation:

water moves through osmosis which is the movement of water molecules from a region of higher concentration to a region of lower concentration.

name a difference between a plant cell and an animal cell.

Answers

Answer:

the cell wall, chloroplasts

Explanation:

plant cells have a cell wall, but animal cells do not

plant cells also have chloroplast, but animal cells don't

easy question - giving brainly if correct !!​

Answers

Answer:

i think its  C

Explanation:

i would go with c

Whales and hippos are thought to have evolved from a common ancestor around 54 million years ago. Which of the following is also true about these species?

Answers

Answer:

Both whales and hippos have almost no hair on their bodies. They do not have sweat glands.

Explanation:

what is occurring during the s phase of the cell cycle?

Answers

The S phase of a cell cycle occurs during interphase, before mitosis or meiosis, and is responsible for the synthesis or replication of DNA. In this way, the genetic material of a cell is doubled before it enters mitosis or meiosis, allowing there to be enough DNA to be split into daughter cells.

Pls give brainliest ❤️

74 POINTS!!!!
How could addressing market failure help make an economy more environmentally sustainable?

Answers

Answer:

If companies are held accountable upfront for the consequences their actions will have on the environment, their actions may be more environmentally friendly from the beginning.

why are cells growing on top of each other even if they have space in culture flask

Answers

Answer:in culture plates cell density of the edges is often more than the center of the dish,

what causes this distribution?

Explanation:

hii everyone i have question again which substances made gages​

Answers

What is the question???

Machines known as “DNA synthesizers” can produce short pieces of DNA.
True or false

Answers

Answer:

Machines known as DNA synthesizers are used to produce short pieces of DNA, up to several hundred bases in length. These synthetic sequences can then be joined to natural sequences using DNA ligase or other enzymes that splice DNA together. A gene from one organism can be attached to the DNA of another organism.

nucleic acids are assembled in the _____ direction.

Answers

5’ to 3’ hope this helps:)

Nucleic acids are assembled in the 5' to 3' direction during DNA replication. DNA replication is the process of duplication of DNA molecule.

What are Nucleic acids?

Nucleic acids are the biomolecules occurring in the chemical compounds which serve as the primary information-carrying molecules in the cells. Nucleic acids play an important role in directing the process of protein synthesis. The two main classes of nucleic acids include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Nucleic acids can only be synthesized in vivo in the 5′-to-3′ direction and these can be assembled in the same direction in cell, as the polymerases which assemble various types of new strands generally rely on the energy which is produced through breaking the nucleoside triphosphate bonds to attach these new nucleoside monophosphates to the 3′-hydroxyl (−OH) group, through a phosphodiester bond.

Learn more about Nucleic acids here:

https://brainly.com/question/11309892

#SPJ6

what does the doctor inject into the child to make the child immune to measles​

Answers

Answer:

MMR vaccine

Explanation:

CDC recommends that children get MMR vaccine to protect against measles, mumps, and rubella.

How are male and female reproductive organs similar?

Answers

Answer: They are the same in that most of the reproductive organs of both sexes develop from similar embryonic tissue, meaning they are homologous. Both systems have gonads (male have testes and female have ovaries) that produce gametes (testes produce sperm and ovaries produce egg or ovum) and sex organs.

Which of the following refers to the transformation of stimulus energy into neural impulses?
A) Perception
B) Bottom-up processing
C) Top-down processing
D) Transduction
E) Psychophysics

Answers

The conversion or the transformation of the stimulus energy into the neutral impulses is know as transduction referring to the five senses. The perception s the process that leads tp the stimulus energy into the neutral impulses.

For example the hue or color and its dimension are determined by the wavelength of light that is perceived.

Hence the option A is correct.

Learn  ore about the refers to the transformation of stimulus.

brainly.com/question/18958345.

how can an understanding of osmosis be important in developing methods for the same storage of food?

Answers

Osmosis is also used for preserving fruits and meats, though the process is quite different for the two. In the case of fruit, osmosis is used to dehydrate it, whereas in the preservation of meat, osmosis draws salt into it, thus preventing the intrusion of bacteria.

what is the role of microfilaments in cell division

Answers

Answer:

. Microfilaments help the cell lay down new membrane and divide into two daughter cells.

Explanation:

why are the larval stages of silk moth and honey bees voracious ?​ please fast answer me

Answers

Answer:

Since that stage is the stage that most of their growth occurs and nutrition is important for their growth. Thus they eat continuously to sustain the growth pattern.

#5 and 6 pleasee I will give you 100 points

Answers

6)it is bigger then we ever thought and that we wont beable to explore it all..

CORRECT ME IF I AM WRONG

6) it is bigger then we ever thought and that we wont beable to explore it all

sorry if this didnt help

Other Questions
find the equations of line parallel to x-2y=6 that pass through (-4,1) Can someone please write the points in a notebook please I really need help 20 points help A number of similar families make up a(n) _____.A orderB classC genusD specie how many times dose the average person do math a day? what is the first thing you draw in creating an angle bisector? A) a curve intersecting both rays B) a line segment intersecting both rays Bases react with carbon dioxide and from............. and water A 73-year-old woman is experiencing recurrent constipation. The woman reports to the nurse that she experiences constipation despite the fact that she takes docusate on a daily basis and performs cleansing enemas several times weekly. How should the nurse best respond to this client's statement What is one benefit of internal storytelling? the brain and spinal cord are components of the ______ nervous system, while the nerves and ganglia are components of the ______ nervous system. HELP PLEASEEEE!!!Which of the following inequalities matches the graph? 10 8. 4 x 2. 6 8 10 --10-8-6-4-2 -2 - -8 -10 | OX-7 Oxs-7 Oy=-7 Oyz-7 Ibrahim spends 1/3 of his earnings on food and 1/4 on clothes. He then saves the rest.what fraction does he (a) spend altogether (b)save 1 What fraction does he (a) spend altogether (b) Save? Write a 125 word summary of what you have learned in "Introducing the Microscope". Be sure to include steps on how to focus, how to solve for magnification, and what a field of view is and how to measure it. What is the expression in factored form?4x2 +11x+6O (2x+3)(2x+2)O (4x+1)(x+6)O (2x+1)(2x+6)(4x+3)(x+2) what is the process where a computer starts up and automatically loads the operating system aWhich picture shows a properreflection across the red dashed line?AB Command economies produce goods that (c) Changing water into vapour is condensation true or false hyper-igm syndrome is a rare genetic disease caused by a loss-of-function mutation in the gene that codes for the cd40l protein. what are the two most likely direct effects of cd40l deficiency? fill in the blank (Geometry B) to derive a competitive advantage, firms can properly configure hr practices to drive ________ which leads to ________.