Which of the following is TRUE about how are rocks deformed?

a. change its size, volume, or shape

b. there will be an equal pull and pushes on the rock from different direction.

c. rock will undergo tectonic pressure

d. there will be unequal pull and pushes on the rock from different direction.​

Answers

Answer 1

Answer:

a

Explanation:

Rocks change its size, volume, or shape because of weather, as well as tectonic pressure.


Related Questions

Match the chemical reactions with their properties. Group of answer choices The reaction has at least two reactants and one product. [ Choose ] The reaction has one reactant and at least two products. [ Choose ] Oxygen is one of the reactants, and a large amount of energy is released. [ Choose ] One or more atoms replaces a part of a compound. [ Choose ] The products are always salt and water. [ Choose ].

Answers

Combustion is a combustion reaction. The substrate reacts with oxygen to release high energy in the form of heat.

Theby  products of neutralization are always salt and water.

Combustion Oxygen is one of the reactants and a large amount of energy is released.

A synthesis reaction has at least two reactants and one by-product.

A decomposition reaction has one reactant and at least two by-products.

Replaces part of a compound by substitution with one or more atoms.

 

Neutralization: When acids and bases react, they neutralize each other to form water and salts. This is a combustion reaction. The substrate reacts with oxygen to release high energy in the form of heat.

Synthesis:  In this case, two reactants react to form a by-product.

Decomposition:  It decomposes one reactant to form the by-product.

What is substitution reaction?

Substitution: In this type of reaction, an atom is replaced by another atom in the reactant.

Therefore it is concluded a combustion reaction. The substrate reacts with oxygen to release high energy in the form of heat.

To know more about combustion reaction refer to the link :

https://brainly.com/question/14949019

Which genetically modified organism will best prevent farmers from losing their crops during transport to grocery stores?
oranges that have a prolonged shelf life
corn with a high yield
butter squash that have high nutritional value
fruit with a vaccine

Answers

Answer:

Probably oranges that have a prolonged shelf life

Compact bone forms concentric rings that make it extremely hard and strong to:.

Answers

Resist stress and protect the inner bone

Choose Griffith, Avery, or Hershey and Chase. Select evidence from the text to develop a flowchart that shows how that scientist or team of scientists used scientific methods. Be sure to identify each method. use your flowchart from the reading tool and content from chapter 1 as a guide.

Answers

Question = what is the genetic material? >> hypothesis = it is composed of DNA >> experimentation = use of radioactive isotopes. It was discovered by Avery by observing bacterial transformation.

What is the scientific method?

The scientific method is a series of steps used to collect scientific evidence in favor of a hypothesis.

A hypothesis is a given explanation about an observation that emerged by analyzing the natural world.

By using the scientific method, Avery showed that DNA is responsible to store the genetic information in bacteria across generations.

Learn more about the scientific method here:

https://brainly.com/question/17216882


A student concluded:
"the bigger an animal, the more chromosomes it has in each body cell.'
This is not a valid conclusion.
Give one reason why.

Answers

Animals have different sizes during their life but the chromosome number stays the same


What happens in the wall of the uterus to push the baby out?

Answers

answer : Normally, the placenta detaches from the uterus and exits the vagina around half an hour after the baby is delivered...

What is a chemical messenger that travels through the body to a certain tissue, on which it exerts a special effect

Answers

Hormones are chemical messengers secreted into blood or extracellular fluid by one cell that affect the functioning of other cells.

REALLY EASY PLS ANSWER

Answers

The answers are b, b, d

The three major components of connective tissue are.

Answers

Answer:

1. specialized cells

2. extracellular protein fibers

3. a fluid known as ground substance

Explanation:

When different genes make for greater or lesser chances of survival and reproduction, natural selection results in the more favorable genes becoming more frequent in a population over time, and populations that have those genetic changes are better able to survive and reproduce. This is called:

Answers

When different genes that make for greater or lesser chances of survival become more frequent in a population, the phenomenon is called evolution by natural selection.

What is evolution by natural selection?

First, evolution is defined as gradual changes to the traits of organisms with time.

Natural selection refers to the tendency of nature to select for or against traits that confer adaptive advantages or disadvantages in organisms respectively.

In a population of the same organisms, the gene that confers greater chances of survival is selected among numerous similar genes. This gene becomes more frequent in the gene pool of the population with time.

Thus, we say that such a population has evolved through natural selection.

More on natural selection can be found here: https://brainly.com/question/2725702

Life processes shown by viruses if they enter a living cell

Im 13 why does it say I am in high school

Answers

the life process is reproduction

What is cell migration and give 2 reasons why it happens

Answers

Answer:

cell migration occurs during vital cellular processes such as tissue renewal and repair, wherein old or damaged cells are replaced by the migration of newly formed cells from the underlying tissue layers.

In an experiment or investigation, what is a control? (1 point) O The variable that changes other variables in the experiment. O The variable that the experimenter controls or changes in the investigation. O The purpose or reason for the experiment or investigation. O The variable that remains unchanged throughout the investigation.​

Answers

Answer:

In an experiment or investigation, what is a control? D. the variable that remains unchanged throughout the investigation

why would a scientist most likely chose to perform a simulation instead of a lab experiment or field observation? B.The lab experiment might be dangerous or too difficult to do.

What are the four types of terrians that the Water Erosion simulation explored? D. Rocky, glacial mountain, hills and plains, and near water body.

Which river channel results from a high-gradient, high-volume river flow? C. striaght with a wide channel.

Which effect does temperature have on the glacial mountain terrain? C. hugh temperature melts glaciers faster and cause water erosion to increase

Explanation:

What is the genus and species of Organism 3 in this mostly fabricated taxonomy table?
Multiple choice question.

A.)Eukarya Animalia Vertebrata Mammalia Bipedia sneakeri

B.)sneakeri

C.)Bipedia sneakeri

D.)Eukarya Animalia

E.)Bipedia Sneakeri

Answers

Answer:

E

Explanation:

if it's going from the widest range (from being common) to the narrowest range ( to being more specific), the species is found at last, and the one above it is its genus.

one mnemonic to remember this is:

Kids Prefer Candies Over Fresh Green Salads.

Kingdom Phylum Class Order Family Genus Species. ( from highest rank to lowest).

i hope this helps you to better understand things,

-s.

The genus and species of Organism 3 in this mostly fabricated taxonomy table is Bipedia Sneakeri. The correct option is E.

What are species and genera?

Species is a term of the organization. It is the largest group of organizations. It contains all the animals which can reproduce and produce actual offspring.

Genus is the ran of an organization that is lower than the family. It contains all living organisms. It comes above species. The scientific name of an organism contains the species and genus.

The organization table here is given to contain different ranks of the organization. The third group of organization tables contains bipedalism. It is a form of locomotion that was ancestral. The apes and monkeys walk like this, using all limbs.

Thus, the correct option is E. Bipedia Sneakeri.

To learn more about species and genera, refer to the link:

https://brainly.com/question/14306908

#SPJ2

Which label correctly identifies that x represents in the concept map

Answers

Answer:

I believe it's autotrophic cell

Explanation:

1.What are the reactants of photosynthesis? (what do you start the reaction with?)

Please help me please and thank you

Answers

Answer:

The raw materials are CO2 (carbon dioxide) and H2O (water). The energy source for the reaction is sunlight.

Explanation:

the equation for photosynthesis is 6CO2 (carbon dioxide) + 6H2O (water)→ C6H12O6 (sugars) + 6O2 (oxygen)

In the body, certain lipids ________.Multiple Choiceare used to make mineralsare necessary for the absorption of dietary fiberprovide energystimulate the production of enzymes

Answers

Answer:

Provide insulation against cold temperatures

Explanation:

What is the mRNA transcript if the complementary DNA is TCTGAG?

Answers

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

The coronavirus doesn't actually make you sick! After someone is infected, what changes to the body actually make someone start to feel symptoms of being sick? (Check two that apply!)
a a fever and cough
b when bacteria move in infect exposed cells
c when your immune system attacks sick and healthy cells
d when the lipid envelopes of your cells dissolve.

Answers

Answer:

a because having a fever and cough is definitely noticable!

Explanation:

In pea plants, round pea peas (R) is dominant to wrinkled peas (r). A plant with round peas is crossed with a plant with wrinkled peas. Of the 52 offspring that come out of this cross, 23 produce round peas and the 29 produce wrinkled peas. The genotypes of the parent plants must be:____________

Answers

Answer:

should be Rr

Explanation:

Which cell absorbs water and mineral salts

Answers

Answer:

root hair cell is the right answer

Bottom trawling is a destructive fishing practice that destroys ocean habitats. Please select the best answer from the choices provided T F.

Answers

Answer: the answe is TRUE

Explanation: got it right on edge

Answer:

T

Explanation:

EDGE 2022

How does a phospholipid behave in water?

Answers

Answer:

In water, phospholipids spontaneously form a double layer called a lipid bilayer, in which the hydrophobic tails of phospholipid molecules are sandwiched between two layers of hydrophilic heads

Explanation:

hope it will help you

Answer: phospholipids form a double layer called a lipid bilayer! Hope this helps! ‍♀️

Explanation:

The main difference between a prokaryotic cell and a eukaryotic cell
is

Answers

The prokaryotic cell has no nucleus and the eukaryotic cell does have a nucleus.

I hope that helps!!!

Answer:

eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not.

Bacteria reproduce by injecting their genes into other cells. Please select the best answer from the choices provided. T F.

Answers

Answer:

false

Explanation:

I took the test

Answer:

F

Explanation:

Good luck :)

What is a major impact of climate change for fish species

Answers

Answer:

a major impact is the temperature rise or drop in certain oceans

Explanation:

trust me bro

The main impact of climate change on fish species is the increase in water temperature.

How does temperature affect fish?

The metabolism of fish is higher as the temperature increases, causing their food consumption to increase in the hot seasons of the year and, consequently, at these times, their growth rate also increases.

With this information, we can conclude that the main impact of climate change on fish species is the increase in water temperature.

Learn more about climate change in brainly.com/question/18784841

what characteristics do you are likely to acquire from your parents?​

Answers

Answer:

Hair color, eye color, skin color, physical shape, dna traits/genes

Explanation:

hope this helps you

Body type and height are some of the characteristics offspring can inherit from their parents.

What is heredity?

Heredity is the scientific study of how characteristics are inherited from parents by offspring.

Genes found in the DNA are the basic units of heredity.

Offspring inherit traits from parents such as

heighthair coloreye color intelligencebody type

Therefore, characteristics such as height and eye color inherited from parents by offspring is the focus of the science of heredity.

Learn more about heredity at: https://brainly.com/question/198623

Unlike animal cells, plant cells have ________ and ________. Unlike plant cells, animal cells have ________.

Answers

cell walls, chloroplasts, large central vacuole, plastids,

At the end of the mitotic cell cycle, a cell divides into two cells. What must happen before the cell divides?.

Answers

Answer:

telophase and cytokinesis probably

Characteristics of viruses include all of the following except

They are smaller than prokaryotic cells.

They are visible with a light microscope.

They are obligatory parasites.

They are acellular.

They are composed of genetic material and protein.

Answers

Answer:

Your answer would probably be D. They are composed of genetic material and protein.

Hope this helps!

Characteristics of viruses include all the following, except is they are acellular. The correct option is D.

What is virus?

A virus is an infectious microbe made up of a nucleic acid segment (DNA or RNA) encased in a protein coat.

A virus cannot replicate on its own; instead, it must infect cells and make copies of itself using the host cell's components.

Thus, the correct option is D, They are acellular.

Learn more about virus

https://brainly.com/question/1427968

#SPJ2

Other Questions
Use the sentence to answer the question.Saturday morning, the shopping center buzzed with activity as people went in and out of stores.Which change would make the language in the sentence more precise?A. replacing buzzed with movedB. replacing shopping center with buildingC. replacing went with dashedD. replacing Saturday morning with earlier How would I Determine the number of moles in 3.51 x 10^23 formula units of CaCl2 What was queen philippa empire ?? Define the term change and state two negative change you may encounter as a student or as an employee in the future What is 3*ln(5)? Expanded and get the exact answer. Please helpjkjjijojoijkninih What volume will 2. 0 moles of nitrogen occupy at 720 torr and 20. 0C? Formula: PV = nRT (R = 62. 396 Ltorr/molK) 3. 5 L 6. 6 L 48 L 51 L. What type of airplane was developed afterWorld War II, due to technologicaladvancements during the war?A. The biplaneB. The jetC. Fixed wing aircraft help!!!! due tomorrow any two difference between negative and positive charge of class 7 please fast a triangle is equal in area to a rectangle which measures 10 cm by 9 cm if the base of the triangle is 12 cm long find its altitude If a student needs to conduct a sugar test on a piece of food, he should crush it with water along with a chemical named ________ In Federalist No. 10, Madison argues that the Constitution disperses power between the federalgovernment and state governments.Which of the following describes a constitutional provision in the newly-ratified Constitution that doesthat?Choose 1 answerA Supreme Court justices receive lifetime appointmentsBMembers of the House of Representatives are directly electedThe president is empowered to make federal appointmentsUS senators were chosen by state legislatures What should a person do to effectively manage diabetes What can the reader most likely infer about the king based on his conversation with the wounded man? (Paragraphs 21-24) What is the mass of 750 atoms of Nitrogen? Write the expression in descending order of y: y^3-y+6-7y^2 A cosmetics company has decided to eliminate several of its underperforming products to focus its energies on its most profitable items. What has the firm decided to do What is the process of pooling and packing mortgage loans into debt securities called?. please help if u can thank you:)