What is the solution to the inequality?
12 < 8 + x
A. x>4
B. x > 20
C. x < 4
D. x< 20

Answers

Answer 1
Correct answer : A
Explanation :
-x<8-12
Change the signs : -x<-4
Answer : x>4
X € ( 4 , + ∞ )

Related Questions

Simplify: -2 (8 - 6s + 11t - 3u)

Answers

Answer:

Step-by-step explanation:

-16 + 12s - 22t + 6u

The answer is 12s - 22t + 6u -16

Solve the equation |2x + 1| = 2(x + 1). Are there any extraneous solutions?

Answers

Answer:

[tex]x=-\frac{3}{4}[/tex]

Step-by-step explanation:

Find the slope of the line that passes through (7,10) and (2,2)​

Answers

Answer:

3/2

Step-by-step explanation:

Lee drew five rectangles as shown on this coordinate grid

Answers

Given:

Lee drew five rectangles as shown on this coordinate grid .

To find:

The correct statement.

Solution:

From the given diagram, it is clear that,

Dimensions of rectangle x are 6 by 3 units.

Dimensions of rectangle A are 7 by 3 units.

Dimensions of rectangle B are 6 by 3 units.

Dimensions of rectangle C are 3 by 6 units.

Dimensions of rectangle D are 6 by 4 units.

Dimensions of rectangle x and B are same and clearly it can be translation or rotation about the origin.

Dimensions of rectangle x and C are same but only rotation is not sufficient to get rectangle C from rectangle x.

Dimension of rectangle x, A and D are different, so they are not congruent and we cannot get rectangle A and D by rotation, reflection and translation.

Therefore, the correct option is B.

You have 22 books in your library. Eight are romance novels, 4 are murder mysteries and the rest are science fiction. Only 15 books will fit on a book shelf. How many ways can you arrange the books?​

Answers

Answer:

The books can be arranged in 170,544 ways

Step-by-step explanation:

This is a combination question since we are arranging

We simply want to find the number of ways to select 15 books out of 22 for arrangement

Mathematically, that will be;

22 C 15 = 22!/(22-15)!15! = 170,544 ways

PLSSS DUE IN 8 MINS.

Answers

Answer:

1, 148, 149.

your welcome

Answer:

E,B,F≥150

Step-by-step explanation:

150≥150

152≥150

151≥150

Jason is buying burgers and fries for his family. Each burger costs $6 and each order of fries costs $4. He has a total of $36 to spend.
**a. Write an equation that represents this situation using x to represent the number of burgers purchased and y to represent the number of fries purchased.

** b. If Jason bought 2 burgers, how many fries did he purchase in order to spend all of his money?

Answers

Answer:

a) $6x+$4y=36

b) 6 fries

Step-by-step explanation:

b)$6(2)=12

36-12=24

24/4=6 fries

x + y = -2

transformed into y form

Answers

Answer:

y = - 2 - x

Step-by-step explanation:

Since x + y = - 2, In the other side, it would be...

y = - 2 - x

Hope this helps :)

Please mark me as Brainliest!! I gave you the right answer.

Is the unit rate of change for the linear function shown in the table?​

Answers

The answer to the question is B

Alondra Escobedo
Arithmetic on Polynomial Expressions
Nov 17,5:32:52 PM
Watch help video
?
If C =- 8 and D = – p2 + 8r+ 7, find an expression that equals 2C + 2D in
standard form.
Answer:
Submit Answer

Answers

Answer:

Is this from delta math lol

Step-by-step explanation:

2c+2d

2(-8)+2(-p2=8r+7)

Now try

I hope this helps

im sorry if it doesn't

BRAINLIEST IF CORRECT!
Which of the following statements contain a variable? Check all that apply.

A. The highest temperature over three days.
B. How much the car weighs.
C. The length of the track.
D. Five feet tall.

Answers

Answer:

D.

Step-by-step explanation:

Rena spent 6 days reading her book completing the same fraction of the book each day if she had a total of 8/9 of her book after 6 days what fraction of the book did she react each day

Answers

Answer:

The fraction of the book that Rena read every day is [tex]\frac{4}{27}[/tex]

Step-by-step explanation:

Rena spent 6 days reading her book completing the same fraction of the book every day and you want to know the fraction of the book she read each day. Knowing that Rena had a total of 8/9 of her book read after 6 days, then you simply divide the total amount of the book read during those days by 6, the number of days:  

[tex]\frac{8}{9}[/tex]÷6

To divide a fraction by a whole number, you must convert the whole number into a fraction, finding the reciprocal of that fraction, and multiply it by the first fraction. That is, you must find the reciprocal of the number that is after the division symbol; and then you multiply the first number (the one before the division symbol) by the reciprocal of the second number (the one after the division symbol). Remember that to find the reciprocal of a number, you simply have to change the numerator and denominator of the number.

Since 6 can be considered to be a fraction equal to [tex]\frac{6}{1}[/tex], by inverting the number, then you get [tex]\frac{1}{6}[/tex]

Then:

[tex]\frac{8}{9}[/tex]÷6= [tex]\frac{8}{9} *\frac{1}{6}[/tex]

Now you multiply the numerators and denominators of the fraction to get the new numerator and denominator of the final solution.

[tex]\frac{8}{9}[/tex]÷6= [tex]\frac{8}{9} *\frac{1}{6}=\frac{8*1}{9*6} =\frac{8}{54}[/tex]

Finally, simplifying the fraction:

[tex]\frac{8}{9}[/tex]÷6= [tex]\frac{8}{9} *\frac{1}{6}=\frac{8*1}{9*6} =\frac{8}{54}=\frac{4}{27}[/tex]

So:

[tex]\frac{8}{9}[/tex]÷6= [tex]\frac{4}{27}[/tex]

The fraction of the book that Rena read every day is [tex]\frac{4}{27}[/tex]

What is the slope of the line through (-1, 4) and (1, -2)​

Answers

Answer:

Slope = -3

Step-by-step explanation:

The slope is the change in y over the change in x

The slope formula is m=y₂-y₁/x₂-x₁ (y over x)

So, plug in your coordinates (the subscript represents the order in which your points are going to be subtracted in)

So, you would get m=-2-4/1-(-1)

Simplify (first subtract the top, then subtract the bottom)

This would get you to -6/2 (remember your rules: a negative and a negative makes a positive)

-6/2 would get you to -3

-3 is the answer

The correct answer is A

PART 1 Please help me 10 points i just joined today ;)

PART 2 is on other question

Answers

Answer:

B=30,000

Y=The Plane's altitude

M= -2,000

X= Minutes

Equation: y=-2,000x+30,000

Slope= ?

Y-intercept= the point where you start at

what is the altitude after 10 minutes?=10,000

How Long does it take to get to 0 altitudes?=15 (Minutes)

Step-by-step explanation:

What are the choices for slope

What is the volume of a cylinder, in cubic cm, with a height of 8cm and a base diameter of 14cm? Round to the nearest tenths place

Answers

Answer:

=1232cm^3

Step-by-step explanation:

Volume of a cylinder=πr^2h

Where r=radius=diameter/2=14/2=7 cm

h=height=8 cm given

π=22/7

Volume of cylinder=πr^2h

=22/7x7x7x8=154x8=1232cm^3

Answer:

1231.5

Step-by-step explanation: the other answer is wrong this is right

Fully simplify to one fraction.
x+3+3x/x+5

Answers

Answer:

[tex] \frac{4x + 3}{x + 5} [/tex]

Step-by-step explanation:

add x and 3x

Find the slope of the line that passes through the points (1,3) and (5,5).

Answers

Answer:

The slope is 1/2

Step-by-step explanation:

y²-y¹/x²-x¹

=5-3/5-1

=2/4

=1/2

Step-by-step explanation:

The best way to solve these is by making them into a equation, rise over run, or y over x.

[tex] \frac{3}{1} - \frac{5}{5} [/tex]

You will get the same answer nomatter which order these are values are in. Now, solve for this equation.

[tex] \frac{ - 2}{ - 4} [/tex]

Now this is negative and kind of messy, although, we can turn both values into positive values without the answer changing, just be careful on other problems with this technique as it doesn't always work.

[tex] \frac{2}{4} [/tex]

Now we can simplify again.

[tex]\frac{1}{2}[/tex]

The slope is 1/2!

Kevin hopes to earn a college basketball scholarship.To improve his shooting skills Kevin shoots 50 baskets./day.If Kevin shoots 50 baskets every day for 60 days how many shots would Kevin take

Answers

In sixty days, assuming that Kevin shoots exactly fifty baskets everyday, he'd have shot 3,000 baskets. (multiply 60 x 50 = 3,000)

Hope this helps: If it did, please mark brainliest, give a thanks, and rate it five stars! [I'm two brainliests away from moving up!] Have an amazing rest of your day and stay safe! Let me know if you need anymore help! xx

The total length of a beach is 13.2 kilometers. If lifeguards are stationed every 0.6 kilometers, including one at the end of the beach, how many lifeguards will there be on the beach?

Answers

Answer:

22 including one at the end of the beach

Step-by-step explanation:

Total length of the beach = 13.2 kilometers

If lifeguards are stationed every 0.6 kilometers, INCLUDING one at the end of the beach

Number of lifeguards in the beach = Total length of the beach / distance interval of each lifeguards

= 13.2 kilometers / 0.6 kilometers

= 22

Number of lifeguards in the beach = 22 including one at the end of the beach

Elena mixes 5 cups of apple juice with 3 cups of sparkling water to make sparkling apple juice. For a party, she wants to make 35 cups of sparkling apple juice. How much of each ingredient should Elena use? Explain or show your reasoning.

Answers

Answer:

25 cups of apple juice and 10 sparkling water 

Step-by-step explanation:

There are 7 cups of sparkling juice in each batch, since 5 + 2 = 7. То make 35 cups Elena will need 5 batches since 5 x 7 = 25. 5 batches mean 25 cups of apple juice and 10 cups of sparkling water

(brainliest?)

find the exponential function that satisfies the given conditions:
-initial value: 56
-decreasing at a rate of 0.42% per week

Multiple choice: possible answers ⬇️​

Answers

Answer:

d

Step-by-step explanation:

Answer:

The second one

Step-by-step explanation:

Hope this helps! Consider brainiest!

Which equation best represents the relationship between x and y in the graph? please guys I need help.

Answers

Answer:

its a or y = -3/4x -3

Step-by-step explanation:

slope-intercept form is y = mx + b where m is the slope and b is the y-intercept. the line intercepts at the y at point -3 so the y-intercept is -3 the slope is -3/4 and you just plug them into the slope intercept form

ANY MATH EXPERTS PLS HELP RN I GOT 30 MIN LEFT I PUT 100 POINTS

Answers

Answer:
4/5
Explanation:
The slope of a line is defined by change in y/change in x. Notice that when the line’s x value changes from -2 to 3, it’s y value changes from 0 to 4. Therefore, the slope is 4/5

Which statement is true about the coordinates of points A and B?

Answers

Answer:

the 4th imagen math box

Step-by-step explanation: trust me pleses

Answer:

y/x of point A=y/x of point B

Step-by-step explanation:

When you graph a linear function, slope refers to the steepness of the line the function makes. The slope of this line is the same as the
of the linear function. The slope can be expressed as a decimal, fraction, or integer.

Answers

Answer:

you are the only person I can be of assistance to

Step-by-step explanation:

ok is the best friends to come in the medicine and the

How to evaluate each expression given the variable replacements

Answers

Answer:

Step-by-step explanation:

I need the expressions, please.

Find the slope between these two points:



(4,2) and (10,5)

Answers

Answer:

Slope is 1/2

Step-by-step explanation:

Slope Formula = m = y2 - y1/x2 - x1

Point = (4,2) and (10,5)

m = y2 - y1/x2 - x1

m = 5 - 2/10 - 4

m = 3/6

m = 1/2

please answer eeeeeeeeeeeeeeeeeeeva

Answers

Answer:

35 students

Step-by-step explanation:

Find 25% of 500:

[tex]\frac{25}{100}[/tex] × [tex]\frac{500}{1} = \frac{12500}{100}[/tex]  [tex]\frac{12500}{100} = \frac{125}{1} = 125[/tex]  

Find 18% of 500:

[tex]\frac{18}{100}[/tex] × [tex]\frac{500}{1} = \frac{9000}{100}[/tex]  [tex]\frac{9000}{100} = \frac{90}{1} = 90[/tex]  

Find the difference:

125 - 90 = 35

So, 35 more students prefer video games to bike riding.

I hope this helps!

What is the value of C49 ?


36


126


6561


3024

Answers

Is there like a chart because I cans understand it it must have a chart or something missing

Using the concept of combination, the value of the expression 9C4 is 126

Recall the combination formula :

[tex]nCr = \frac{n!} {(n-r)!r!} [/tex]

[tex]9C4 = \frac{9!} {(9-4)!4!} [/tex]

[tex]9C4 = \frac{9 \times 8 \times 7 \times 6} {4 \times 3 \times 2 \times 1} [/tex]

[tex]9C4 = \frac{3024} {24} = 126 [/tex]

Therefore, the value of the expression 9C4 is 126.

Learn more : https://brainly.com/question/18405415

Shryia read a book cover to cover in a single session, at a constant rate. After reading for 1.5, point, 5 hours, she had 402 out of the total 480 pages left to read.

Answers

Answer:

y = -52x + 480

Step-by-step explanation:

Let us assume the number of pages left be x

And, the number of hours is x

According to the question

Data given is as follows

Number of hours 1.5 and 5

Total pages 480

Left pages 402

Based on the above information,

The computation is shown below;

Pages read by Shriya in 1.5 hours is

= Total pages in the book - left pages to read

= 480 pages - 402 pages

= 78 pages

And, there is 1.5 hours

So in one hour she read

= 78 pages ÷ 1.5 hours

= 52 pages per hour

So, the equation is

y = -52x + 480

Other Questions
3 + 2y = 143 - 2y = 10 Please help me w the equation and please dont take advantage of the points. Help I'm confused!This is the beginning sequence of the first exon in the mRNA sequence:AUGAAGCUCUUUUGGUUGCUUUUCACCAUUGive the DNA/genomic sequence it was transcribed from. is this correct? answer plz!! Use the Distributive Property to Factor the Expression6b+ 6 which one do you like more THUMB TACKS, PUSH PIN TACKS OR OTHER TACKS or no tacksdont forget to add the name of the tack if you say other if g(x)=2(x-4), find the value of x if g(x)=201) 322) 123) 144) 10please HELP How does Baines depict the working environment in the cotton mill ? Is it safe or dangerous? Where does the path of light change when interacting with different materials?boundary of oil and glassBboundary of water and glassboundary of oil and waterDAll of the above A crystalline solid of unknown origin forms an aqueous solution that conducts an electrical current. The solid has a high melting point and shatters when struck with a hammer. The solid is likely to be ______ Why are primary producers also referred to as autotrophs? plzzzz help!!!a) They are able to change chemical energy into light energy.b) They are able to transfer energy throughout an ecosystem.c) They are able to release energy from other organisms in an ecosystem.d) They are able to transform energy from an unusable form to a usable form. Which one of the next salts is the most soluble in water, if: Ksp (BaCO3) = 5.1 10-9 mol2 / l2; Ksp (CaCO3) = 4.8 10-9 mol2 / l2; Ksp (BaSO4) = 1.1 10-10 mol2 / l2? * 5. How should free water have been administered to the patient? someone please help with my math question on my page/account Suzanne is following a fad diet. She has started to experience low energy during her workouts, and on a recent trip to the doctor, she found out she has high cholesterol. Which fad diet is Suzanne most likely following?A. low-carbohydrateB. low-fatC. fastingD. diuretics At the beginning of the month, Kimberly had $65.78. Since then,she has received three payments of $32.50 from her babysitting job. Kimberlys 2 sisters each helped her babysit once during the month,so Kimberly paid them $8.75. If Kimberly did not spend any money, how much money does she have now how to email teacher asking when do we have test Louis owns a rectangular piece of property with an area of 1 3 4 square miles. The length of the property is 2 1 3 miles. What is the width of the property? Consider the reaction of lead(II) nitrate reacting with sodium phosphate to create lead(II) phosphate and sodium nitrate. If 37.1 g of lead(II) phosphate was created in the reaction, how much (mass) sodium phosphate was originally needed to produce this amount of product lol this is actually science