Which of the following might use various colors to represent information found in a visual aid?
a.

Caption

c.

Legend
b.

Scale

d.

Abbreviation



Please select the best answer from the choices provided

A
B
C
D

Answers

Answer 1

Answer: C. Legend

Explanation: On Edge!


Related Questions

Why does dally ultimately decide yo rob a grocery store?​

Answers

Because he lost hope when Johnny died. He denied that Johnny had the knife or that Johnny was dead. He robs a grocery store to get the attention of the police.

Hope this helps answer your question!!:))

list three effects that will occur when Nya’s village finally gets water.

Answers

Answer:

☝hi how are u............

whats your favirote crisp?????

Answers

Answer:

Walkers Cheese and Onion.

Explanation:

hope it helps

As a group, review the satire techniques on page 268. Then, write a group analysis of the author's use of the techniques in "girl moved to tears of mice and men cliffs notes."

Answers

Answer and Explanation:

The author uses the satirical techniques known as reversal and exaggeration to show how Weaver's laziness in doing a correct reading and analysis of the text made her believe that she would do an exemplary job, but presented a mediocre, boring and inefficient work. The author uses these techniques to show how lazy is absurd and to make readers laugh at the shameful situation in which Weaver put himself on his own. The story is even more satirical by the people who know the text she should have read, because it shows conclusions totally out of reality.

Can people who answer questions on here just say the answer and then write the explanation after? I'm sure you have to do it like that so that brainly gets that sweet money from the ads, but i speak for every student on here when i say its anoyying and incompentent to have to spam refresh the page just to see the answer. Put the answer first.

Answers

Answer:

You're so totally righteous.

Explanation:

Drag each label to the correct location on the table.
Identify the characteristics of major characters and minor characters.
also known as primary characters
also known as
secondary characters
contribute to but are not
essential to the plot
influence the plot and
other characters
major characters
minor characters
Reset
Next

Answers

Answer:

Major characters - also known as primary characters, influence the plot and other characters

Minor characters - also known as secondary characters,  contribute to but are not essential to the plot.

Explanation:

Every story has its major (primary) and minor (secondary) characters.

Major characters are the ones that the plot follows most of the time. We get to see their development from the beginning to the end. The major characters we encounter in most stories are the protagonist, antagonist, and the character through whose eyes we're watching the story unfold (often this character and the protagonist are one character).

Minor characters are also important, but not as important as major characters. They appear in fewer scenes are not as essential to the development of the plot. We often don't see their development. They are there to support the development of the major characters and reveal more about them.

ead the sentence a student wrote.

As he listened to the haunting notes of the song the author realized he had found the inspiration for his next suspense novel.

The teacher reviewing this sentence would point out that since this is a

complex sentence, there should be a comma after “song.”
compound sentence, there should be a comma after “realized.”
complex sentence, there should be a comma after “inspiration.”
compound sentence, there should be a comma after “found.”

Answers

Answer:

complex sentence, there should be a comma after “song.”

Explanation: hope this helps

Answer:

A. complex sentence, there should be a comma after “song.”

Explanation:

5. My backpack weighs a ton!

A. idiom
b. alliteration
c. hyperbole

Answers

Answer:

HYperbole it is exaggerated

Explanation:

1.) How would you define Self-Control in your
own words?
2.) What is an example of using Self-Control?
Read the question above^ Type 5 complete sentences. Give explanation(s). Provide an example(s). Explain in your own words

Answers

Self control is being able to control anger ,sadness,and sparks of energy.An example of using self control is when your mad at someone and your reading to yell take a deep breath and think is what i'm about to say nice or helpful .If your able to calm you have self control.

Its not 5 but its should be good :)


In this preface, Elie Wiesel lays
out his case for telling his story
of his experiences in
concentration camps during the
Holocaust. He explains that
doing so was painful, but he had
compelling reasons to tell it.
What are his various reasons?
Provide evidence from the text to
support your answer.

Answers

Answer:

All the pain he went through and he still managed to make it

Explanation:

He is proud of himself because he was able to survive all the pain and suffering that he went through

Which leader raised taxes to pay for expensive buildings and attacks on the Greeks?
A.
Cyrus the Great
B.
Darius I
C.
Xerxes I
D.
Cambyses

Answers

Answer:

c Xerxes

Explanation: cause he raised taxes

Answer:C.

Xerxes I

Explanation: Im pretty sure this is the right answer if its not let me know

"You Guys are just perfect"
You're beautiful/handsome
You rock

Answers

Answer:

Fifteen minutes could save you 15% or more on car insurance,

Explanation:<3

Which detail from "The Chenoo" would best support the theme "family bonds are strong"? The two brothers remember a story their great-grandfather told them. Both men run back toward their camp to check on their sister. Nolka heats a pile of rocks for her brothers' evening sweat lodge. Nolka's brothers stop talking when she holds up a hand to her mouth.

Answers

Answer:

Both men run back toward their camp to check on their sister.

Explanation:

Joseph and James Bruchac's short story "The Chenoo" is a folktale about a mythical creature that has a heart of ice and kills any man he comes across. And through the brave act of the three siblings, the "curse" on the monster was lifted and they got their grandfather back.

While her brothers went hunting, Nolka was at their tent preparing whatever game they brought back. On the day the brothers discovered the footprints of the Chenoo, she was unaware of it. So, once the brothers figured out that the prints were headed to their camp, they rushed back to their sister, fearing for the monster to kill her. This act of rushing back shows the bond of family, the ties that bind them so strongly together.

Thus, the correct answer is the second option.

Answer:

B.

Explanation:

Hope that helps! Have a great Christmas!!!

how do u remove an answer on one of ur questions on this thing lol im new and someone put nonsense and i want to take their point back. THXXX

Answers

Answer:

you can't unfortuantly you have to report it and wait for someone to delete it the person that deletes it is a special person called a monerator and controls all the awnser and can delete any awnser so to report you press the flag in the corner of the awnser and expalin why then press save and them wait

Explanation:

Answer:

you cant exactly delete the question but you can report it.If you want to see if the answer has been deleted you should check a bell that you you have on the upper right corner and there it will say if a moderator deleted it or not but a person called a moderator should delete it right away if you report it which essentially they check brainly to make sure everyone is doing what they are supposed to

Explanation:

hope this helps !

Which of the following inferences would you be least likely to make based on the information you learned about ben Jonson

Answers

Answer:

7 - 5=90

Explanation:

Answer:

C. Jonson never got over the loss of his son.

This is the right answer according to my corrected quick check. Confusing question.

1. b. a short piece of writing to memorialize a significant event

2. b. the child will never experience the hardships of life.

3. b. reverential

4. a. wherever there is a chance for a fabulous meal.

5. c. Jonson never got over the loss of his son.

Read this information about the work environments of
various careers.
Compare and contrast the careers. Which of these
statements is correct?
Actors work in a variety of places, including in studios, on
stage in theaters, and at theme parks or other live events.
O Secretaries and accountants both work mainly in
offices.
O Marine biologists and secretaries both get to work
outdoors.
Firefighters work at fire stations or at the scenes of
accidents or emergencies.
Accountants work in an office setting.
O Accountants work in a variety of settings, but actor
do not.
O Firefighters get to work outside, but marine
biologists do not
Secretaries work in a variety of different office settings.
Marine biologists work in the environment, exploring
ocean life and its ecosystems.

Answers

Answer:

Accountants work in a variety of settings, but actors do not.

Explanation:

25 Points

New Technology Leads to Bigger Cities

In the 1800s, the United States was still a very young nation, trying to solidify its identity. The Industrial Revolution began in Great Britain, a fast development of society following the introduction of machines. The United States was slower than Great Britain to fully embrace the changes. Yet key technological developments caused a rapid growth in American urban areas.

Better farming methods and tools in the 1800s increased food production. Americans were able to grow enough food for their families as well as to sell. The abundance caused food prices to fall.

The expansion of cotton and the growth of textile factories in northern states helped produce the first wave of American industry. More people turned to work in northern factories as a way to support their families. Thousands of immigrants to the United States also settled in or near port cities, looking for work. Even today, the need for work is a common reason people move to urban areas.

As a result, cities grew in numbers of people and physical space. As more people and businesses moved in, they needed buildings for living and working. They needed ways to move around the city. We call this process urbanization.

In 1820, the United States had only a few cities of 10,000 residents or more. About seven percent of U.S. residents lived in urban areas. The number of cities with more than 10,000 people grew quickly over the next 40 years, especially in the Northeast and Midwest. By 1860, about 20 percent lived in cities. Philadelphia and New York City were the most populated cities in 1860 and would soon reach one million residents.

The urbanization of the United States quickened due to technology improvements. Without innovations in food production, the factories could not have grown so quickly. The trend quickened after 1860 and continued throughout the 21st century as well. By 2007, more Americans lived in or near cities than they did in rural areas.

Select a sentence from the body of this article that can be removed without affecting the author's explanation. Place the sentence in quotes and explain why it is an unnecessary detail.

Answers

Answer: "The urbanization of the United States quickened due to technology improvements. Without innovations in food production, the factories could not have grown so quickly. The trend quickened after 1860 and continued throughout the 21st century as well. By 2007, more Americans lived in or near cities than they did in rural areas." Because it just in one the previous sentences it already said that food was aplenty.

Explanation: But you could remove "As a result, cities grew in numbers of people and physical space. As more people and businesses moved in, they needed buildings for living and working. They needed ways to move around the city. We call this process urbanization." because after it talks about the population already being grown.

Read the sentence.

Before attempting to undertake a career in the film industry, it’s important to investigate the skills and qualifications required, as one should with any job.

To put the sentence in formal style, which is the best revision to make?

changing “undertake” to “go for”
changing “it’s” to “it is”
changing “investigate” to “check out”
changing “job” to “gig”

Answers

I believe you should change "it's" to "it is". It shows you have proper grammar, because the other words aren't as formal. (I do apologize if it is wrong).

Answer:

B-it's to it is

Explanation:

When you use notecards to organize the paragraph of your essay you should write ___ on a separate note card

Answers

Answer:  

- Subject.

Explanation:

Organizing is one of the crucial elements to produce an effective essay as it arranges the thoughts and information in a structured manner. Note cards are most commonly employed to organize the paragraphs. The process begins with titling the 'subject or topic' on separate cards along with its description/notes and separate them in groups as per the topic and length of the paper. It helps in giving a concise and compact form to the ideas in a systematic and more presentable manner with highlighting each point sharply that offers a comprehensive meaning and understanding to the essay/paper. Thus, 'subject' is the answer.

The subject of each supporting paragraph. :)

2. The old door creaked open.

a. hyperbole
b. alliteration
onomatopoeia

Answers

Answer:

Onomatopoeia

Explanation:

An Onomatopoeia is a noise like slap, crack, or moo.

Hope this helps!

I beleive it is onomatopoeia.

GIVING BRIANLY, FOLLOW AND 5 STARS
a. stories can change our lives
b. without a story, we are not complete​

Answers

Answer:

a

Explanation:

the word change is highlighted

Answer:

I would think the answer is A

Explanation:

Because the author explains that the books changed over time and that show that Stories can change our lives

Which effect was this poster intended to create

Answers

Answer:
Which effect was this poster intended to create?
A.) It was created to inspire women to join the military during the war.
Explanation: It is correct

Answer:

a

Explanation:

Which best describes the first paragraph of a research report?
A. the final paragraph of a report that clarifies and summarized key points
B. the introduction that presents the report’s topic and hooks the reader’s attention
C. the paragraph that includes the most important facts about the chosen topic
D. the descriptive paragraph that answers your research question

Answers

Answer:

A. The final paragraph of a report that clarifies and summarized key points.

Explanation:

In the first paragraph of a research paragraph you are introducing the beginning of your report.  You will introduce your research claim, and briefly state what you will be learning.

If this helped could you please brainliest!!

The first paragraph of a research report is a introduction that presents the report’s topic and hooks the reader’s attention. Thus, the correct answer is option B.

What is a research report?

Research reports are written data that are created by statisticians or researchers after they have analyzed material acquired over the course of organized research, generally through surveys or other qualitative approaches.

The research report starts with the first paragraph. The research claim is presented and a brief summary of the findings is given. The opening should be written to grab the reader's interest and describe the research's primary objective.

In the opening paragraph, it is made obvious what the issue is about, what the major facts are, and why it is important. It also provides background information and the current state of knowledge on the subject.

Thus, the option B is the best description for the first paragraph of a research report.

To learn more about research report, click here:

https://brainly.com/question/30026064

#SPJ2

what is the main idea in winnie the pooh
iknow its a silly question but its an odd one also how is this 8th grade?

Answers

Answer:

Childs Psyche and Friendship. your welcome :D, can I get brainliest?

Explanation:

Which of these sentences is written in iambic pentameter? A. I baked my friend a birthday cake today. B. Susan wrote me a friendly letter. C. "Still I Rise" is my favorite poem. D. She danced along to the song on the radio.

Answers

Answer:

D. She danced along to the song on the radio.

Explanation:

Option D is the correct answer because it is written in iambic pentameter.

An iambic pentameter refers to the line that has a pattern or rhythm that has to do with the number of syllables in the line and the emphasis placed on those syllables. In an iambic pentameter, from the word "pent", it's clear that the line has 5 stressed syllable.

For an iambic pentameter in a poem, every single line of that poem will definitely have five stressed syllables.

William Shakespeare's works are known to be often used as examples of iambic pentameter.

Answer:

The correct answer is A

Explanation:

The author introduces her essay by relating an anecdote from her vacation in France (paragraphs 1 and 2) primarily to


praise the widespread custom of European napping

praise the widespread custom of European napping
A

confirm her audience’s suspicion that napping is inefficient

confirm her audience’s suspicion that napping is inefficient
B

offer advice to Americans traveling in rural France

offer advice to Americans traveling in rural France
C

establish a cultural comparison for her argument about napping

establish a cultural comparison for her argument about napping
D

explain the daily routine of a French lockkeeper

Answers

Answer:

C Establish a cultural comparison for her argument about napping.

Explanation:

The author has tried to mention the custom of European napping. It is a mid day pause from the routine works to feel the individual fresh every day. The person can have a short break from his work and enjoy the time doing things that make him feel fresh again. The author has made comparison from the other countries who do not follow such rituals.

which elements are most important to analyze when you need to compare the themes of two short stories?

a. the title of each story
b. how the characters in each story change and why
c. descriptive details about the setting
d. the cultural background of each author

Answers

I think it’s b because that would be the main thing.

The variations in the characters provide hints as to which parts of human nature the author wishes to emphasize.

The author's purpose in changing the characters is to demonstrate what works and what doesn't as people solve problems or conquer difficulties.

There could be a lesson to be learned—and that is the theme's essence: an understanding of human nature.

Thus, Option B is correct.

In a short story, what is the theme?

The term "theme" refers to the fundamental meaning of the story. It's the message the story's author is attempting to convey. The subject of a narrative is often a broad message about life.

A narrative's topic is significant since it is part of the author's motivation for writing the story.

For more information about Themes refer to the link:

https://brainly.com/question/11108997

#SPJ2

What are some examples of produce of the animals’ labour?

Answers

Answer:

some major ones are milk, eggs

Explanation:

they require animals

Select the words that are capitalized correctly.

The Baltimore ______ , a team in the _____ League, will do a lot for the

Answers

There all in a row

✔ Ravens  

✔ National

✔ Football  

✔ community

Answer:

There all in a row

✔ Ravens  

✔ National

✔ Football  

✔ community

hope this helps

Explanation:

HELP ME PLZZE I NEED HELP WITH THIS!! I CAN'T FAIL SO PLZZ HELP ME

Answers

Answer:

Its b because I think that "Aidan", yes he did restate the question and told whether or not he agreed with them but he did not give a reason or any details as to why he supported the ban of dodgeball.

Explanation:

Hope this helps! maybe mark me brainliest?

Other Questions
how the different occupation help our society? Makayla and Ember went shopping for OD gear and spent $262.00. If the tax rate is 5%, what is Makayla and Embers total after tax?$267.00$1,310.00$275.10$13.10 3. What are some of the differences between the Roman Republic and thegovernment of the United States? Write the ratio 7 : 4 in the form n : 1 pleaseee help me will mark brainliest Which is an example of a high-risk behavior that increases the likelihood of contracting an STI?a)using a public restroomb)having multiple sexual partners c)sharing a glass of waterd)holding hands with a partner reasons why would people be against voluntary assisted dying Suppose y varies directly as x. If y = 30 when x = 8, find y when x = 4. 1 + 1 I'm confusedddddddddddddddddddddddddddddddddddddddddd 3 + 2y = 143 - 2y = 10 Please help me w the equation and please dont take advantage of the points. Help I'm confused!This is the beginning sequence of the first exon in the mRNA sequence:AUGAAGCUCUUUUGGUUGCUUUUCACCAUUGive the DNA/genomic sequence it was transcribed from. is this correct? answer plz!! Use the Distributive Property to Factor the Expression6b+ 6 which one do you like more THUMB TACKS, PUSH PIN TACKS OR OTHER TACKS or no tacksdont forget to add the name of the tack if you say other if g(x)=2(x-4), find the value of x if g(x)=201) 322) 123) 144) 10please HELP How does Baines depict the working environment in the cotton mill ? Is it safe or dangerous? Where does the path of light change when interacting with different materials?boundary of oil and glassBboundary of water and glassboundary of oil and waterDAll of the above A crystalline solid of unknown origin forms an aqueous solution that conducts an electrical current. The solid has a high melting point and shatters when struck with a hammer. The solid is likely to be ______ Why are primary producers also referred to as autotrophs? plzzzz help!!!a) They are able to change chemical energy into light energy.b) They are able to transfer energy throughout an ecosystem.c) They are able to release energy from other organisms in an ecosystem.d) They are able to transform energy from an unusable form to a usable form.